ID: 998536102

View in Genome Browser
Species Human (GRCh38)
Location 5:142932229-142932251
Sequence TGAAACCAGTGTACCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998536097_998536102 21 Left 998536097 5:142932185-142932207 CCTAGTGCAGTGATTTTTGCTGC 0: 1
1: 1
2: 1
3: 14
4: 191
Right 998536102 5:142932229-142932251 TGAAACCAGTGTACCAGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 137
998536096_998536102 22 Left 998536096 5:142932184-142932206 CCCTAGTGCAGTGATTTTTGCTG 0: 1
1: 0
2: 2
3: 15
4: 189
Right 998536102 5:142932229-142932251 TGAAACCAGTGTACCAGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998536102 Original CRISPR TGAAACCAGTGTACCAGAGG TGG Intronic
901945394 1:12698515-12698537 GCAAACCAGTGTAGCAGAAGAGG - Intergenic
903628601 1:24748929-24748951 TGAAAGCAGTGGACCAGGTGTGG + Intronic
903695164 1:25201072-25201094 AGAAACAACTGTAACAGAGGAGG - Intergenic
904728001 1:32564922-32564944 TGCTACCATTGTAGCAGAGGTGG - Intronic
907219644 1:52896818-52896840 TGAAAGCAGTGTGCAAGTGGAGG - Intronic
907988086 1:59552708-59552730 GGAAATCAGTGTATCACAGGAGG - Intronic
908730851 1:67225302-67225324 TGAAACCATAGTACTATAGGAGG + Intronic
910143039 1:84047613-84047635 TGAAACCAGTGTGAAAGAGTAGG - Intergenic
910856894 1:91704803-91704825 TAAAAACAGTGGCCCAGAGGAGG + Intronic
911456337 1:98128939-98128961 GGATATCAGTGTACCTGAGGGGG - Intergenic
917927622 1:179802395-179802417 TGAAAGCAGAGGACCAGATGTGG - Intronic
918483937 1:185009637-185009659 TGAAACCAGTGTAAAATAGTGGG - Intergenic
923706881 1:236351329-236351351 TGATACCGGTGGGCCAGAGGAGG + Intronic
923908595 1:238413963-238413985 TAACAACAGTGTAGCAGAGGTGG + Intergenic
1065359562 10:24876878-24876900 AGACTCCAGTGTACCAGTGGAGG - Intronic
1066334220 10:34459957-34459979 TGGAGACAGTGTACCTGAGGAGG - Intronic
1068145792 10:53069013-53069035 AGAAAGCAGAGTACAAGAGGAGG + Intergenic
1069073569 10:64014884-64014906 TGAGTCCATTGTACCAGATGTGG + Intergenic
1069880020 10:71586409-71586431 TCAATTCTGTGTACCAGAGGTGG - Intronic
1073918091 10:108429208-108429230 TAAAACCAGGGCACCAGAGAGGG + Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078764805 11:14285524-14285546 TGAATACAGAGTACCAGAGATGG - Intronic
1078903303 11:15661532-15661554 AGACACCAGAGTACTAGAGGTGG - Intergenic
1079009520 11:16816857-16816879 TGAAGCCACCGGACCAGAGGAGG - Exonic
1083900561 11:65641343-65641365 TGAAGCCAGGGTCCCAGAGCTGG - Exonic
1084742158 11:71146820-71146842 TGAAGCAAGAGTCCCAGAGGTGG - Intronic
1085206461 11:74736028-74736050 TAAAAGCAGCGTACTAGAGGGGG - Intergenic
1085409241 11:76281749-76281771 GGGCACCAGTGCACCAGAGGAGG + Intergenic
1087177730 11:95110513-95110535 GGAACCCAGTGTACCAGGGAGGG - Intronic
1089492104 11:118890261-118890283 TGAAAGCAGTTTCCCAGAGAAGG - Intronic
1091788894 12:3259909-3259931 TGATAGCAGTGTAGCAGTGGAGG + Intronic
1092540951 12:9419461-9419483 TGACCCCAGTGTCACAGAGGGGG - Intergenic
1100870861 12:98908498-98908520 TGATACCAGTTTTCCAGATGAGG - Intronic
1101299710 12:103466651-103466673 TGCAATCAGTGTACCACATGGGG - Intronic
1101714191 12:107296046-107296068 TGTAACCAGAGGCCCAGAGGTGG - Intergenic
1104607731 12:130202387-130202409 TGAAACCAGTGTGGCAGGGTTGG + Intergenic
1105802607 13:23921733-23921755 TGTAACCACAGCACCAGAGGTGG - Intergenic
1106050773 13:26187493-26187515 TATAACCAGTTCACCAGAGGGGG - Intronic
1111805649 13:93038017-93038039 TGAAAACAGTCTGTCAGAGGTGG + Intergenic
1113107297 13:106785737-106785759 AGAAACAAGTTTACCAGAAGTGG - Intergenic
1113520594 13:110937828-110937850 AGAAACCAGTGACCCAGTGGCGG + Intergenic
1116132354 14:40872301-40872323 TGAAATCATTGCACCAGAAGAGG + Intergenic
1120015450 14:79468033-79468055 TGAGACCAGAGTGCCAGAGTGGG + Intronic
1123671598 15:22664646-22664668 GGGAAGCAGTGTTCCAGAGGCGG - Intergenic
1124323637 15:28737871-28737893 GGGAAGCAGTGTTCCAGAGGCGG - Intronic
1126063135 15:44803129-44803151 TGAAAACAGTATATAAGAGGAGG + Intergenic
1127315568 15:57791179-57791201 TGAGACCAGGGAACAAGAGGAGG + Intergenic
1130372034 15:83293272-83293294 TGAGACCACAGTACCAGAAGAGG + Intergenic
1132769611 16:1554014-1554036 TGAAACCAGAGAAGGAGAGGTGG - Intronic
1133488895 16:6248116-6248138 AGGAGCCAGTGTACCAGAAGAGG + Intronic
1134512462 16:14859460-14859482 TCAAACTAGTGTTCCAGAGATGG + Intronic
1134700102 16:16257961-16257983 TCAAACTAGTGTTCCAGAGATGG + Intronic
1134971724 16:18536701-18536723 TCAAACTAGTGTTCCAGAGATGG - Intronic
1137591409 16:49696408-49696430 TGAAACAAGGCTACCAGAGAAGG + Intronic
1138964571 16:62068722-62068744 TAAAACCATTGTACTAGAGGAGG + Intergenic
1139272788 16:65699342-65699364 TGAAACCAGAGTTGGAGAGGCGG + Intergenic
1142600570 17:1051617-1051639 TGTTCCCAGGGTACCAGAGGTGG + Intronic
1148654900 17:49276031-49276053 TGAAACTGCTGTGCCAGAGGTGG - Intergenic
1149973142 17:61238852-61238874 TGAAACGTGTGTCCCAGAGGTGG + Intronic
1151418568 17:73982756-73982778 GGAAACCAGGGTCACAGAGGAGG - Intergenic
1154983488 18:21524640-21524662 TGAAACAATTGTACCTGGGGTGG + Exonic
1156555868 18:38067795-38067817 TCAAACCAGGGAACCAGAGAAGG + Intergenic
1159654011 18:71010598-71010620 TGAAACCAGTGTAAAAAAGAGGG + Intergenic
928117048 2:28552983-28553005 TGCAAGCTGTGTACCTGAGGTGG - Exonic
931626901 2:64264444-64264466 TGCATCTAGTGTACCAGAAGGGG + Intergenic
933504158 2:83156498-83156520 TGAATGCAGAGTACAAGAGGAGG - Intergenic
935592297 2:104854707-104854729 TGAAACGAGAGGACCAGAGGGGG + Intergenic
935698543 2:105790528-105790550 GGAAACCAGGGCTCCAGAGGTGG - Intronic
937399350 2:121568311-121568333 TGTAACCACTGGACCAGAGAGGG + Intronic
938084371 2:128389132-128389154 TGAAATCAGTGTGCCAGCAGGGG + Intergenic
938215576 2:129510237-129510259 TGAAGCCACTTTACCAGATGTGG + Intergenic
941182625 2:162278691-162278713 TGAAACCAGTTTTACAAAGGAGG - Intronic
941843118 2:170108863-170108885 TGAAACCAGTGTAGCAGAGCCGG + Intergenic
942033930 2:171992251-171992273 TAAAACCAGTGTATCAAAGATGG - Intronic
943122994 2:183760684-183760706 TGAAATCAGAGTACTAGTGGAGG + Intergenic
1169685442 20:8266606-8266628 TGAAACCAATCTACCACAGATGG + Intronic
1174393675 20:50233350-50233372 TGAAAACAGTGGAACAGAGAAGG - Intergenic
1175080081 20:56412239-56412261 TGAAAGCAGTGAAGCAGGGGAGG - Intronic
1175981709 20:62741970-62741992 TGAGACCTGTGTGCCTGAGGTGG + Intronic
1178819546 21:35962725-35962747 AGACACCTGTGTACCAGTGGTGG - Intronic
1179155848 21:38850445-38850467 CGAAACCAGTGAAGCAGAGCAGG - Intergenic
1179293868 21:40043400-40043422 CAAAAACAGTGTTCCAGAGGAGG - Intronic
1182250122 22:28993438-28993460 GGAAACCAAGGTACGAGAGGTGG + Intronic
1182266470 22:29119672-29119694 TGAAAGCTGTCTACCAGAGTTGG + Intronic
1184266254 22:43348209-43348231 TGAAAACAGACTAGCAGAGGTGG - Intergenic
950613281 3:14139516-14139538 TGAGACCAGTGCCCCAGAGTTGG - Intronic
951665827 3:25122608-25122630 TGATATCAGAGTACCAGATGGGG - Intergenic
952842930 3:37663551-37663573 GAAAACCAGTCTTCCAGAGGAGG + Intronic
953483491 3:43272786-43272808 TGAATCCAGTTTACCAGAAATGG - Intergenic
954737907 3:52721981-52722003 TGAAACCTGTGATCCAGAGTGGG + Intronic
954915915 3:54148588-54148610 AGGAACCAGTGGACCACAGGTGG + Intronic
955125571 3:56107548-56107570 TGAAAGCAGAGTATCAGAGGTGG - Intronic
957690465 3:83559282-83559304 TGAAACCAGTGAAAGAAAGGTGG + Intergenic
965490092 3:169324653-169324675 GGAAGACAGTGAACCAGAGGAGG - Intronic
965901126 3:173643709-173643731 TGCAACCAGGCTACCAGAGTTGG + Intronic
968027330 3:195453449-195453471 TGAATCCAGTTTTCCAGGGGTGG + Intergenic
968445424 4:649958-649980 TGAAACCAGGGTGACAGCGGTGG - Intronic
968763813 4:2457847-2457869 TGCACCCAGTGCACCTGAGGAGG + Intronic
969353615 4:6612597-6612619 TGAAGCAAGGGAACCAGAGGTGG - Intronic
970587186 4:17525957-17525979 TGAAACCAGAGGAAGAGAGGGGG + Intronic
973708441 4:53602356-53602378 TGACACCAGTGAAGGAGAGGAGG + Intronic
974974628 4:68874863-68874885 TGAAACTAAAGTACCAGAAGGGG + Intergenic
976352768 4:84079058-84079080 TGATACCAGTGAACCATAGTGGG + Intergenic
979888658 4:126062997-126063019 TGCAGCCACTGTACCAGATGTGG - Intergenic
982326011 4:154128793-154128815 GGAAACCAGTGCTCCAGAGTAGG + Intergenic
984833848 4:184000642-184000664 TGAACCCAGTGTTCAAGAGTAGG - Intronic
988491396 5:31708353-31708375 GGAAACCAGTGTCCTAGAAGAGG + Intronic
988504470 5:31809884-31809906 TGTGACCAGGGTACCAGAGGAGG - Intronic
993656415 5:90583539-90583561 TGAAAGAAGTGTGCCAGGGGAGG - Intronic
996475210 5:123910716-123910738 TGAAGCCAGTTTCCCACAGGTGG - Intergenic
997386348 5:133475846-133475868 TGAGAGCAGGGTAGCAGAGGTGG - Intronic
998536102 5:142932229-142932251 TGAAACCAGTGTACCAGAGGTGG + Intronic
1007749335 6:44062564-44062586 TGAAACCAGTGGGCAAGATGGGG - Intergenic
1008619877 6:53261296-53261318 TGAAATAACTGTACCAGAGAAGG - Intergenic
1009928274 6:70146161-70146183 TAAAACCAGTGTACCTGACTGGG - Intronic
1011665584 6:89629840-89629862 TGAAACCACAGTTCCAGAGATGG - Intronic
1012982095 6:105841583-105841605 AGAAACCAGTGTCTCTGAGGAGG - Intergenic
1015089048 6:129331814-129331836 TGAATCCAGTATAGAAGAGGAGG - Intronic
1018163102 6:161066973-161066995 TGATATCATTATACCAGAGGCGG + Intronic
1023878674 7:44306706-44306728 TGAAACCAGTGAGCAGGAGGAGG + Intronic
1024302102 7:47894769-47894791 TGAACCCAGTAGCCCAGAGGGGG + Intronic
1027774457 7:82445771-82445793 TGGAAACAGTGTACCATAGTGGG - Intergenic
1028883123 7:95902384-95902406 TAAAACCAGTGTAGCAAAGGGGG - Intronic
1034776526 7:153832389-153832411 TGAAATCAGTGTACAGAAGGAGG - Intergenic
1039269793 8:35868334-35868356 GGAAACCAGTGGAACAGAGCAGG - Intergenic
1046030354 8:108775836-108775858 GGAAACCAGGGTACCAGAGCCGG - Intronic
1048351072 8:133617088-133617110 TTAAACCAGGGCAGCAGAGGTGG - Intergenic
1050838776 9:10119354-10119376 TCAATCCAGTGTACCATAGAAGG - Intronic
1051018593 9:12512881-12512903 TGACATCTGTGTACCAGAGAAGG - Intergenic
1052721915 9:32182314-32182336 TGCAACCAATGCACCAGAGGTGG - Intergenic
1052750145 9:32481985-32482007 TGGAAGCAGGGTACCTGAGGTGG + Intronic
1058605461 9:106717496-106717518 TGAACCCAGTTGCCCAGAGGTGG + Intergenic
1059266570 9:113037922-113037944 TGAATTTAGTGTAACAGAGGGGG - Intergenic
1059599623 9:115762615-115762637 TGAAAGCAGAGAATCAGAGGGGG + Intergenic
1059857353 9:118414717-118414739 TGAAACCAGCTTCCCAGATGTGG + Intergenic
1060864774 9:126987087-126987109 CGGAGCCAGTGTCCCAGAGGAGG + Intronic
1061713477 9:132503622-132503644 TGAAAACCTTGTGCCAGAGGTGG + Intronic
1185987297 X:4849587-4849609 TGAACCCAGTTTCCCAGTGGTGG + Intergenic
1186060411 X:5699257-5699279 TGAAACCAGTACACCAGACTGGG - Intergenic
1187393330 X:18900199-18900221 CGACTCCAGTGTCCCAGAGGGGG + Intronic
1189992884 X:46611413-46611435 TAAAACCAGTTTATCACAGGTGG + Intronic
1190337596 X:49271599-49271621 GGAAACCAGGATTCCAGAGGTGG + Intronic
1190913560 X:54793430-54793452 TGAAACAAAGATACCAGAGGAGG - Intronic
1192195830 X:69027479-69027501 TGAAACCAGTGGAGGAGGGGTGG + Intergenic
1196105073 X:111886711-111886733 TGAATCCACAGTACCAGAGAGGG - Intronic
1197224708 X:123945383-123945405 TGAAATCACTGAACCAGAGTTGG + Intergenic
1199310533 X:146315244-146315266 TGCAGCCACTGTACCAGATGTGG - Intergenic