ID: 998538445

View in Genome Browser
Species Human (GRCh38)
Location 5:142956070-142956092
Sequence TTGGTATTAAGCATAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998538440_998538445 2 Left 998538440 5:142956045-142956067 CCATATTGTGTAATGAAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998538445 Original CRISPR TTGGTATTAAGCATAATTGT GGG Intronic
904484469 1:30815699-30815721 ATATTATTAAGCATATTTGTTGG + Intergenic
905196183 1:36279400-36279422 TTGTTCTTAAGCATTATTTTGGG - Intronic
908055179 1:60278232-60278254 TTGGTACTATTCATGATTGTAGG + Intergenic
908241430 1:62192296-62192318 ATGATATTAAGAATAACTGTTGG - Intergenic
910503518 1:87923032-87923054 TTGGTACAAAAGATAATTGTGGG + Intergenic
911842095 1:102695698-102695720 TTGCTATTATGTATACTTGTTGG - Intergenic
911843009 1:102708375-102708397 TGGGTACTAAGCATAATACTTGG + Intergenic
912218553 1:107645172-107645194 CTGGGCTTAAGCATAATTCTTGG - Intronic
914826343 1:151140202-151140224 TTGGTATTAAGAATAGCTTTTGG - Intronic
914945256 1:152059905-152059927 TTGGTGTTCCGCATAATTGCTGG + Intergenic
916153318 1:161818416-161818438 TTGGTATTAAACAAAAAAGTAGG + Intronic
917175389 1:172229203-172229225 TGTGAATTAAGCATAATGGTTGG - Intronic
917590256 1:176469227-176469249 TTTCTCTTAAGCCTAATTGTTGG + Intronic
920145396 1:203856879-203856901 TAAGGATTGAGCATAATTGTAGG - Intergenic
924294682 1:242574043-242574065 TTGGAATTCAGAATAATTATAGG - Intergenic
1063473581 10:6308666-6308688 TTAGAATTAAGCCTAACTGTAGG - Intergenic
1065044484 10:21734622-21734644 TTGTTATTAAGCATACTTTTGGG + Intronic
1065251541 10:23820323-23820345 ATGGCATTAAACAAAATTGTTGG - Intronic
1065616265 10:27527948-27527970 TTGATATTAAACATATTTGGGGG - Intronic
1066150838 10:32615111-32615133 TTGCTATTATGAATAATTCTAGG + Intronic
1066240740 10:33532413-33532435 TTGCTATTTAACATAATTTTTGG - Intergenic
1068262837 10:54605632-54605654 TTAGTAGTAACCATAAATGTTGG + Intronic
1068303045 10:55170581-55170603 CTGGTAGAAAGCATAATTGATGG + Intronic
1068841739 10:61622661-61622683 TTTATATTAAGCATAATAGAAGG - Intergenic
1069524051 10:69151596-69151618 TTGCTTTTAAGCCTTATTGTAGG - Intronic
1070076353 10:73140290-73140312 TTGTTTTTAAGCATATTTTTAGG + Intronic
1072022062 10:91411596-91411618 TTGGTGTTAGGAATAATTTTCGG + Intronic
1072840913 10:98772668-98772690 TTTGCATTAAGCACAATTCTAGG - Intronic
1079066059 11:17294120-17294142 TTGTTATTAAAAGTAATTGTGGG + Intronic
1079943879 11:26716856-26716878 TAGATATTAAGAATAATTTTAGG - Intronic
1088732072 11:112692565-112692587 TTGATATTTGGAATAATTGTAGG - Intergenic
1089820188 11:121218725-121218747 CTGGTTTTAACCATTATTGTGGG - Intergenic
1092917751 12:13203530-13203552 TTTGCCTTTAGCATAATTGTTGG + Intronic
1093202321 12:16203611-16203633 TTTTTATTAAGTATATTTGTAGG - Intronic
1093548251 12:20372463-20372485 TTGTTGCTGAGCATAATTGTGGG + Intronic
1093821968 12:23631324-23631346 TTGTTCTTCAGCCTAATTGTTGG - Intronic
1096057912 12:48670223-48670245 TAGGTACTGTGCATAATTGTAGG - Intronic
1098003823 12:65973805-65973827 ATGCTATTAATCATGATTGTAGG - Intergenic
1098339979 12:69441735-69441757 TAGGTATTAAGAGTAATTGGTGG + Intergenic
1098446744 12:70573794-70573816 ATTGTATTAATCATAATTCTTGG - Intronic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1110480739 13:75973129-75973151 TTGGAAGTAAGTAAAATTGTTGG - Intergenic
1110873645 13:80482546-80482568 ATGGTACTGAGAATAATTGTTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115178106 14:30589028-30589050 TTTTTGTTAAGCTTAATTGTAGG + Intronic
1116298671 14:43147107-43147129 GGTATATTAAGCATAATTGTAGG + Intergenic
1117067925 14:52029131-52029153 TTGATATTAAAAAAAATTGTTGG - Intronic
1117711646 14:58536201-58536223 TTGGTATATTGCTTAATTGTGGG + Intronic
1123184998 14:106508076-106508098 TTTGTGTTATGGATAATTGTGGG + Intergenic
1125036159 15:35126456-35126478 TTGGAATTTAGCACATTTGTAGG - Intergenic
1126892966 15:53225889-53225911 TTAGTATTCAGGATATTTGTTGG + Intergenic
1127058910 15:55162015-55162037 TTTGTAGTAACCATTATTGTGGG - Intergenic
1127468498 15:59268548-59268570 TTGGTTTTCTGCATAATTTTTGG - Intronic
1127667956 15:61167651-61167673 TTGGTTTTCAACATAAGTGTGGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1129625627 15:77195646-77195668 TTGGTATAAAGTATACATGTAGG - Intronic
1132236267 15:100224200-100224222 TCGGTATTAACCATCATGGTGGG + Intronic
1137451292 16:48577162-48577184 TTGGCATTAGTCATCATTGTTGG - Intronic
1138838180 16:60463841-60463863 TAGGTATTAAACATAATATTGGG - Intergenic
1138993832 16:62424053-62424075 TTAGTATAAAGAATTATTGTCGG - Intergenic
1139213244 16:65101592-65101614 TTGGTATTTACCATAATAGGGGG - Intronic
1140338318 16:74132772-74132794 ATGGTATGAAGAATAATTCTGGG + Intergenic
1140968568 16:79991044-79991066 ATGGTATTAATCATAAGTATGGG - Intergenic
1143733873 17:8896944-8896966 TTGATATTAATCATAGTTGCTGG - Intronic
1143802160 17:9392286-9392308 TTGCTAAGAAGCATAGTTGTTGG + Intronic
1144471727 17:15548765-15548787 TTGGTATTAACCACAATTTGAGG - Intronic
1144924751 17:18795940-18795962 TTGGTATTAACCACAATTTGAGG + Intronic
1146136299 17:30323794-30323816 TGGGTATTCAGGATATTTGTGGG + Intronic
1155347130 18:24868531-24868553 GTGGCATTAAGAATAAATGTTGG + Intergenic
1155484420 18:26326753-26326775 TTGCTAGTAAACATCATTGTGGG - Intronic
1156107844 18:33687411-33687433 TAGGTATTTCACATAATTGTAGG - Intronic
1158700415 18:59740524-59740546 TTGTGATTAATCATAATTTTGGG + Intergenic
1159037547 18:63292333-63292355 TTGTTATTAATCATTATTCTGGG - Intronic
1159084817 18:63776609-63776631 CTGGTATGAAGCATAGTTTTTGG + Intronic
1159793241 18:72810658-72810680 TGTGTCTTAAGCAGAATTGTAGG - Intronic
1160302193 18:77692252-77692274 TTGCTATTAACATTAATTGTGGG - Intergenic
1164439696 19:28264275-28264297 TTGGCATTATGCACATTTGTGGG + Intergenic
1164900663 19:31918749-31918771 TTGCCATTAAGCCTAATGGTAGG + Intergenic
927667045 2:25040183-25040205 TTTGTGTTGAGCAGAATTGTGGG + Intergenic
932098627 2:68875504-68875526 TTGGCATTATGTAAAATTGTTGG - Intergenic
932117722 2:69068326-69068348 GTGCTATAAAGCAAAATTGTGGG + Intronic
932828907 2:74969196-74969218 TAGGAATTAAGCATACTAGTCGG - Intronic
935030848 2:99320596-99320618 TTGGTATGAAGGACAATTATTGG + Intronic
938142876 2:128811228-128811250 TTGATTTCAAGCAAAATTGTAGG - Intergenic
938943433 2:136189187-136189209 ATGTTATTAAGCATAATGTTTGG + Intergenic
939257703 2:139765583-139765605 GTGATATTAAGAACAATTGTGGG + Intergenic
942274431 2:174309422-174309444 TTGGTTATAAAAATAATTGTTGG - Intergenic
942382830 2:175410421-175410443 TTGCTATTTGGAATAATTGTGGG + Intergenic
942707323 2:178790979-178791001 TATGTATTAAGCACAAGTGTAGG - Intronic
945154200 2:206820926-206820948 TTGATAGTCAGCATTATTGTGGG + Intergenic
947258460 2:228192690-228192712 TTAGCATTAAGCAGAATGGTGGG + Intergenic
947318045 2:228885088-228885110 TTCCTATTTAGCATAATTCTGGG - Intronic
1169015121 20:2285813-2285835 TTGGTAGTAAGCATGACAGTAGG + Intergenic
1170106907 20:12761403-12761425 TTTGAATTTAGAATAATTGTGGG - Intergenic
1170596992 20:17813439-17813461 TTGTTAATAAACATCATTGTTGG + Intergenic
1172075627 20:32294647-32294669 TTGCTATTAACCATACTTGGTGG + Intronic
1176187366 20:63788336-63788358 GTGATATTAATAATAATTGTGGG - Intronic
1176418479 21:6494860-6494882 TTGGTAATTAGCATAATGGAGGG + Intergenic
1178816719 21:35936966-35936988 TTTGTATTCAGCACAATGGTAGG - Intronic
1179693972 21:43103182-43103204 TTGGTAATTAGCATAATGGAGGG + Intronic
1181808454 22:25389580-25389602 TTGGAATCAAGCTTAAGTGTCGG + Intronic
1183795537 22:40113992-40114014 TTGATATCCAGCATAATTCTTGG - Intronic
951054552 3:18132682-18132704 TGGGTAGTAAGCAACATTGTAGG - Intronic
951328870 3:21341349-21341371 CTGGTATTAAACATGATGGTGGG - Intergenic
955768044 3:62365320-62365342 TTGATATAAAGAATAGTTGTTGG + Intergenic
955930807 3:64054866-64054888 TAGGAATTAAGAAAAATTGTTGG - Intergenic
959927820 3:111944451-111944473 TTGGTATTAAGCAACATTTATGG - Intronic
963070608 3:141302239-141302261 TTGCTATTAAGCCTATTTGAGGG + Intergenic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
964641519 3:158914361-158914383 TTAGGATTAAGGATGATTGTTGG + Intergenic
965155938 3:165055574-165055596 TTGTTTTTAAGCATCCTTGTAGG + Intronic
972384589 4:38552605-38552627 TTGATATTAAGCATATTTACTGG - Intergenic
973177523 4:47226070-47226092 TTGCTATTAAACATAGTTCTAGG + Intronic
974635321 4:64556651-64556673 TTGCTACTAAGAATAACTGTGGG - Intergenic
974835574 4:67245596-67245618 TTGATATTAATTATAATTGGTGG - Intergenic
977422081 4:96814144-96814166 TTGGTATAAAGAGTATTTGTAGG - Intergenic
979088808 4:116451703-116451725 CTGGTTTTAAATATAATTGTGGG + Intergenic
981746723 4:148059376-148059398 TTGGCATTAAACAGAATTGGTGG + Intronic
988032619 5:25783624-25783646 TTTGTATTAGGCATTATTCTAGG + Intergenic
991370994 5:65919701-65919723 TTGGAATTAAACATAATTCGAGG - Intergenic
993165545 5:84349513-84349535 TTGGTGACAAACATAATTGTGGG + Intronic
995363959 5:111333112-111333134 TTAATATTAAGCATAATTGAAGG + Intronic
995907205 5:117139753-117139775 TTTGTATTCACCATTATTGTTGG - Intergenic
996048577 5:118906559-118906581 ATTTTATTAAGCATAATTATTGG - Intronic
996209017 5:120782105-120782127 TTGGTATTATGGTTTATTGTGGG - Intergenic
998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG + Intronic
998729593 5:145059814-145059836 TTGGTATTAAGCTTAATACCTGG - Intergenic
999030572 5:148286338-148286360 TTGGTGGTAAGTATAATTTTAGG - Intergenic
999160620 5:149493879-149493901 CTGGTATAAAGCATTATTTTAGG - Intronic
1002083949 5:176758000-176758022 TGGGTACTAAGCTTAATAGTGGG + Intergenic
1002292997 5:178212298-178212320 CTGGGATTAAGCATACCTGTGGG + Intronic
1004431490 6:15549106-15549128 TTGGAGTTAAACAAAATTGTAGG - Intronic
1006594057 6:35179732-35179754 TAGGCATTCAGCATACTTGTTGG - Intergenic
1006664404 6:35680457-35680479 TTAGTATTAGGCATAATTAATGG - Intronic
1008614730 6:53215386-53215408 TTGTTATCAGGCATAATTTTAGG - Intergenic
1012555828 6:100510415-100510437 GTGGTATTAAAGTTAATTGTAGG - Intronic
1013864926 6:114684459-114684481 TTGGCATTAAGGATAATAGTGGG - Intergenic
1013883986 6:114939262-114939284 TTTGTATAAAGAAAAATTGTTGG - Intergenic
1016601659 6:145868400-145868422 GTGATATTAAGCAGAGTTGTGGG - Intronic
1020898958 7:13978918-13978940 TTGGTAATAAGGTTAATTATTGG - Intronic
1021097732 7:16552185-16552207 TTGTTATGAAGCATAATTTCAGG + Intronic
1023321147 7:38999027-38999049 GAGTCATTAAGCATAATTGTTGG - Intronic
1024305685 7:47927562-47927584 TTGTTATTAAGAAAATTTGTCGG - Intronic
1027342805 7:77227278-77227300 ATGGTTTGAAGCCTAATTGTAGG - Intronic
1027394833 7:77743640-77743662 TTGGTGTTAGGCATAAGTGTAGG + Intronic
1028453809 7:91016622-91016644 CAGGTCTTAAGCAGAATTGTAGG + Intronic
1031046699 7:116897221-116897243 TTGGTTTTAAACATACTTTTGGG + Intronic
1033904141 7:146180678-146180700 TTGGTATGAAGAATAAATGGAGG - Intronic
1037101811 8:15055937-15055959 TTGCTATTAAGTTTAGTTGTTGG - Intronic
1041296990 8:56367346-56367368 TTAGTAATAATTATAATTGTTGG - Intergenic
1043653486 8:82630887-82630909 TTTATATTAAGCAAAAATGTTGG + Intergenic
1046273284 8:111923653-111923675 TTGTCACTAACCATAATTGTAGG - Intergenic
1047587679 8:126292512-126292534 TTGATATAAAGCATAATTCATGG - Intergenic
1055181312 9:73390190-73390212 TTTGTATTAATAAGAATTGTTGG + Intergenic
1058257431 9:102785664-102785686 TTGTGACTAAGCATAATTCTAGG + Intergenic
1058399791 9:104601876-104601898 TTGTGATTAAGCATCATTTTTGG + Intergenic
1060123095 9:121014298-121014320 TTAGTATTTAGCTTAATTGCAGG - Intronic
1186590687 X:10926913-10926935 TTGTTATAAAACATAATTCTTGG + Intergenic
1187683537 X:21792888-21792910 TTGGCATGAAGAATAATTTTTGG - Intergenic
1188570432 X:31578827-31578849 TTGTTGTTAATAATAATTGTTGG - Intronic
1188765263 X:34082710-34082732 TTGGTATTAAGCATGGTGGCTGG - Intergenic
1192741783 X:73900396-73900418 TGGGTATATTGCATAATTGTGGG - Intergenic
1194287342 X:92026092-92026114 TAGGTACTAAGCATAATTCCCGG + Intronic
1195023712 X:100854700-100854722 TTGGTTATAAAAATAATTGTTGG - Intronic
1195726087 X:107918152-107918174 TTCATATTTAGCATAATTCTTGG - Intronic
1196373742 X:115008004-115008026 TTACTACAAAGCATAATTGTCGG + Exonic
1197464600 X:126787046-126787068 TTGGAATTGAGCATACTTCTGGG - Intergenic
1197970653 X:132111574-132111596 TTGTCATTCAGCATATTTGTGGG + Intronic
1198894390 X:141436330-141436352 TTAGGATAAAGCAGAATTGTAGG - Intergenic
1200604877 Y:5250658-5250680 TAGGTACTAAGCATAATTCCCGG + Intronic
1202086070 Y:21138178-21138200 TTGTTAATAAGCATATTTGGTGG + Intergenic