ID: 998540002 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:142971879-142971901 |
| Sequence | GGAGTTTAAGATACAGTTGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 219 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 17, 4: 201} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998540000_998540002 | -9 | Left | 998540000 | 5:142971865-142971887 | CCTATGTGATACACGGAGTTTAA | 0: 1 1: 0 2: 0 3: 5 4: 60 |
||
| Right | 998540002 | 5:142971879-142971901 | GGAGTTTAAGATACAGTTGTGGG | 0: 1 1: 0 2: 0 3: 17 4: 201 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998540002 | Original CRISPR | GGAGTTTAAGATACAGTTGT GGG | Intronic | ||