ID: 998540002

View in Genome Browser
Species Human (GRCh38)
Location 5:142971879-142971901
Sequence GGAGTTTAAGATACAGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998540000_998540002 -9 Left 998540000 5:142971865-142971887 CCTATGTGATACACGGAGTTTAA 0: 1
1: 0
2: 0
3: 5
4: 60
Right 998540002 5:142971879-142971901 GGAGTTTAAGATACAGTTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998540002 Original CRISPR GGAGTTTAAGATACAGTTGT GGG Intronic