ID: 998540514

View in Genome Browser
Species Human (GRCh38)
Location 5:142977188-142977210
Sequence CCTCATAATGAGCAATTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998540514 Original CRISPR CCTCATAATGAGCAATTGCA AGG Intronic
903970656 1:27116837-27116859 GCTCATATGGGGCAATTGCAAGG - Intronic
905003216 1:34689696-34689718 CCTGAGAAGGAGCAATTGTAGGG - Intergenic
905210772 1:36372733-36372755 CCTCAGAATGAGGCATTTCAGGG + Intronic
911460654 1:98185472-98185494 TCTGATAATTAGCAATTGCAAGG + Intergenic
922271883 1:224043056-224043078 CCTCAAAGTGGGCATTTGCAAGG - Intergenic
922445228 1:225691266-225691288 TCTCAAAATGAGTAACTGCAGGG + Intergenic
922714304 1:227858900-227858922 CATCAAAATGAGCATTTGCATGG - Intergenic
1064238099 10:13596093-13596115 ATTCATAATAAGCAAATGCAAGG - Intronic
1068386051 10:56329136-56329158 CCACATAATGAACAATAGCCTGG + Intergenic
1069637335 10:69933196-69933218 CCCCATAATGGGCACTAGCATGG + Intronic
1073991375 10:109265981-109266003 CCACACAAGGAGCTATTGCAAGG + Intergenic
1079275954 11:19037988-19038010 CCTTACAATGAGAAATTGCAGGG - Intergenic
1080847750 11:36041177-36041199 CCTCATAATCAGGACTTCCATGG - Intronic
1086944007 11:92827321-92827343 CAACTTAATGAGCAGTTGCAGGG + Intronic
1087448584 11:98287705-98287727 AATCATACTGAGCAATTGAATGG + Intergenic
1091468096 12:703177-703199 CCTCCTACTGACCAATTGCTAGG - Intergenic
1092298869 12:7225847-7225869 CATCATTCTGAGCAATCGCAAGG - Intergenic
1094059512 12:26298786-26298808 TCTTTTAATGAGCAATTGAAGGG - Intronic
1095603831 12:44044192-44044214 CCTCAAGAAGAGCAATTACAGGG - Intronic
1095761301 12:45840099-45840121 ACTCATAATGAGCCAGTGGAAGG - Intronic
1110789422 13:79570655-79570677 CCTCATGATGAGAGATTGGAAGG + Intergenic
1111455333 13:88475620-88475642 CATCACAAAGAGAAATTGCAGGG + Intergenic
1116071285 14:40048638-40048660 CCTCAGCATGAGCGAATGCATGG + Intergenic
1119957132 14:78810569-78810591 CTTCATATAGAGCAAATGCAAGG - Intronic
1120586854 14:86322370-86322392 TCTCAGAATGTGAAATTGCAGGG - Intergenic
1129955805 15:79635668-79635690 ACTCATAATGAGCCATTGTCAGG + Intergenic
1132629294 16:909062-909084 TCTCATGATGAGCACTTGCCGGG - Intronic
1137538466 16:49345257-49345279 CCTCATTATCAGCTAATGCATGG - Intergenic
1137841865 16:51648504-51648526 ACTCATAATTAGCAATCACAGGG - Intergenic
1138817365 16:60217907-60217929 CCTTTTAATATGCAATTGCAGGG + Intergenic
1141556176 16:84838129-84838151 ACTCATAATTAGAAAATGCAGGG + Intronic
1143970948 17:10795290-10795312 CCTCAATATGAGCCACTGCATGG + Intergenic
1146064898 17:29626660-29626682 CGTCATGAAGAGCTATTGCAAGG - Exonic
1153088382 18:1316233-1316255 CCTCATAGAGAGCAGTTCCAAGG - Intergenic
1154144773 18:11858093-11858115 CCTCTTCATGATCAATTCCATGG + Intronic
1155245060 18:23900184-23900206 CCTCAGACTGAGCAATAGCTGGG + Intronic
1157980326 18:52372368-52372390 CCTCATAACCAGCCAATGCATGG - Intronic
1164536599 19:29090491-29090513 CTTCATAATCACCATTTGCAGGG - Intergenic
1167963327 19:53124589-53124611 CCTCAGAATGTGCAATTGTTAGG - Intronic
924979665 2:207994-208016 CCCCATGAAGAGCCATTGCAAGG + Intergenic
926246307 2:11124216-11124238 CCTCATAGTTAGCAATTCCATGG + Intergenic
929359785 2:41073869-41073891 CCTTATAATGAGCACTTCCATGG + Intergenic
930200843 2:48550913-48550935 CCTCTAAGTGAGCAATTGTATGG + Intronic
931836616 2:66105697-66105719 CTTCATAATTAGCATTTACAAGG + Intergenic
934233191 2:90205487-90205509 CCTTTTAATATGCAATTGCAGGG + Intergenic
937684228 2:124678329-124678351 CCACAGAATGAGCAATTACTGGG + Intronic
938687354 2:133752600-133752622 TCTCATAATTAGCACTAGCAAGG + Intergenic
942921316 2:181376692-181376714 CTCCATAATGACCAATTGGAGGG - Intergenic
942996233 2:182263784-182263806 CCTCATAATTAGCAGTTGTAAGG - Intronic
944748085 2:202678430-202678452 CCTCTTAATATGCAAATGCAGGG + Intronic
1170344930 20:15374923-15374945 CCTCATGATAAGCAATTGTCTGG - Intronic
1170966683 20:21079013-21079035 CCTCTTAATTAGCAAATCCAAGG + Intergenic
1182701664 22:32244951-32244973 CATAATAAAGAGGAATTGCAAGG + Intronic
1183425370 22:37736238-37736260 CCTCCCAATGAGCTATTGCCAGG - Intronic
949618255 3:5780622-5780644 CCTGATAAAGAGCAAATTCAAGG - Intergenic
951574733 3:24101941-24101963 CCACAACATGAGTAATTGCAGGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954029088 3:47805338-47805360 CCTCGTGATGAGGAATAGCAAGG + Exonic
956652504 3:71518063-71518085 CCTCTTAATGAACAACTGCTTGG + Intronic
957188920 3:76981035-76981057 CCTAATAATGTTCCATTGCATGG + Intronic
958966702 3:100566516-100566538 CCTCAAAAAGGGCCATTGCAAGG - Intronic
959783543 3:110265765-110265787 CCTCTTAATGTTTAATTGCAGGG - Intergenic
959787493 3:110318205-110318227 CCTCATCATAAGCTATTCCAGGG + Intergenic
962526139 3:136239224-136239246 CCTCATTATGAGCTAGTGAAGGG - Intergenic
965199165 3:165634226-165634248 CCTCACAATTAGCAATTAAAGGG + Intergenic
965426270 3:168527635-168527657 CCACTTAATGAGCATTTTCAAGG + Intergenic
969886435 4:10219475-10219497 CCTCAAAATTAGCATTTGTAAGG - Intergenic
970178332 4:13361962-13361984 CCTCAGAAGGGGCAATTGAAGGG + Intronic
971527970 4:27645439-27645461 CCAGTTAATGAGCAATTCCAAGG - Intergenic
976844433 4:89471664-89471686 TCTGATAATGTGAAATTGCAAGG - Intergenic
978534491 4:109746706-109746728 CCTCATATTGAGCAGTTACATGG - Intronic
980689875 4:136281437-136281459 CCTTATAATATGCAAATGCACGG + Intergenic
991354193 5:65750506-65750528 GCCCATAATGAGCAATTCCTGGG - Intronic
994033051 5:95167176-95167198 CATCATTCTGAGCTATTGCAAGG - Intronic
998540514 5:142977188-142977210 CCTCATAATGAGCAATTGCAAGG + Intronic
998844679 5:146296444-146296466 TCACATAATGAGCAATGACATGG - Intronic
1000886337 5:166751979-166752001 TTTCATAATAAGCAATTACATGG + Intergenic
1001889889 5:175330036-175330058 CCTCACACTGAGAAATGGCAAGG + Intergenic
1014963189 6:127713014-127713036 CATCACATTGAGCAATTTCAGGG - Intronic
1026441527 7:70448827-70448849 CTTTATAATGAACAATTGCTTGG - Intronic
1029912189 7:104164842-104164864 CCCCAGAATTTGCAATTGCATGG - Intronic
1036294200 8:7522110-7522132 CCTCACAATGTGGAAATGCACGG - Intergenic
1036295974 8:7537525-7537547 CCTCACAATGTGGAAATGCAGGG - Intergenic
1036326592 8:7783494-7783516 CCTCACAATGTGGAAATGCAGGG + Intergenic
1036328362 8:7798881-7798903 CCTCACAATGTGGAAATGCACGG + Intergenic
1039037167 8:33372427-33372449 ACTCATAATGAGCCCTTTCAAGG - Exonic
1043088650 8:75870053-75870075 CCTCATGTGGTGCAATTGCAAGG - Intergenic
1048921367 8:139233533-139233555 CATTATAATCAGCAATTGCCAGG - Intergenic
1053168958 9:35864849-35864871 GTTCATTATGAGCAAGTGCACGG + Intergenic
1056474524 9:86940901-86940923 CCTCTTAAAGAGGAACTGCAGGG - Intergenic
1186979694 X:14945629-14945651 CCTCAACATGAGCAGTTTCATGG - Intergenic
1187050284 X:15688951-15688973 CCTCTTTGTGAGCAATGGCATGG + Intronic
1187058697 X:15764868-15764890 CCTCTTTGTGAGCAATGGCATGG + Intronic
1197840918 X:130745678-130745700 CTTCATAAATAGCCATTGCAGGG - Intronic
1199529316 X:148829263-148829285 CCTCTCTATGAGCACTTGCATGG + Intronic
1200939902 Y:8770401-8770423 CCTCATAGTAATCCATTGCATGG - Intergenic