ID: 998542769

View in Genome Browser
Species Human (GRCh38)
Location 5:142998497-142998519
Sequence CTGTGTTTGTAAATGTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 590}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998542766_998542769 1 Left 998542766 5:142998473-142998495 CCACTTGGTTGCCTTGGCTGCTG 0: 1
1: 0
2: 3
3: 38
4: 428
Right 998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG 0: 1
1: 0
2: 4
3: 63
4: 590
998542768_998542769 -10 Left 998542768 5:142998484-142998506 CCTTGGCTGCTGGCTGTGTTTGT 0: 1
1: 0
2: 6
3: 48
4: 429
Right 998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG 0: 1
1: 0
2: 4
3: 63
4: 590
998542763_998542769 16 Left 998542763 5:142998458-142998480 CCTACTGGGCTTAGTCCACTTGG 0: 1
1: 0
2: 0
3: 2
4: 96
Right 998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG 0: 1
1: 0
2: 4
3: 63
4: 590
998542762_998542769 17 Left 998542762 5:142998457-142998479 CCCTACTGGGCTTAGTCCACTTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG 0: 1
1: 0
2: 4
3: 63
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998542769 Original CRISPR CTGTGTTTGTAAATGTATGT TGG Intronic
900546746 1:3233652-3233674 CTGTGTTAGTAAAGTTATGTAGG - Intronic
901474163 1:9477732-9477754 ATGTGTGTGTATATGTGTGTGGG - Intergenic
901776820 1:11565734-11565756 CTGTGGCTGTAAATTTATTTGGG + Intergenic
902386266 1:16077747-16077769 CCGTGATTCTAAATGTATCTGGG - Intergenic
902904291 1:19543302-19543324 CTGTATCTGTAAATTTATGATGG + Intergenic
903265146 1:22153729-22153751 ATGTGTGTGTGAATGTGTGTTGG + Intergenic
903659980 1:24970972-24970994 CTGTGTGTGTGAGTGTGTGTAGG + Intergenic
904029738 1:27526750-27526772 CTGTGTATGGAGGTGTATGTAGG + Intergenic
904123598 1:28220146-28220168 GTGTGTTTGTATGTGTATGTAGG - Intronic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
905174366 1:36126580-36126602 CTGTGTGTGTACGTGTAGGTGGG + Intergenic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905556911 1:38893364-38893386 CCGAGTTTTTAAATGTATTTGGG + Intronic
905903480 1:41597875-41597897 CCTTGTTTGTAGATGTGTGTAGG - Intronic
906300851 1:44680613-44680635 CTTTGTTTGTATATTTATTTGGG + Intronic
906457961 1:46013847-46013869 GTGTGTGTGTATATGTGTGTTGG + Intronic
906582423 1:46947071-46947093 CTGTCTTTGTAGATGGATTTTGG - Intergenic
906583193 1:46953242-46953264 CTGTCTTTGTAGATGCATTTTGG - Intergenic
906601184 1:47130806-47130828 CTGTCTTTGTAGATGCATTTTGG + Intergenic
907222049 1:52914354-52914376 CTGTGTGTGTGCATGCATGTTGG + Intronic
907381127 1:54090359-54090381 ATGGGTTTTTAAATGAATGTTGG + Intronic
907553134 1:55321119-55321141 GTGTGTGTGTGAGTGTATGTTGG + Intergenic
907602736 1:55787184-55787206 CTGTCTTTGTAGATGGATTTTGG + Intergenic
908048507 1:60200357-60200379 ATGTGTTTCTAAATGTATGTAGG - Intergenic
908433492 1:64081803-64081825 GTGTGTTTGTGTATGTGTGTGGG - Intronic
909095343 1:71279869-71279891 CTGTGTTTTTAAAATTCTGTAGG - Intergenic
909154763 1:72059561-72059583 ATGTGTTTATAATTGTATATTGG - Intronic
909780172 1:79535295-79535317 CTTTATTTTTGAATGTATGTTGG + Intergenic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
910825768 1:91405304-91405326 CTGTTTTTATAAATTCATGTTGG - Intergenic
910904575 1:92161707-92161729 CTGTGTTAGTAAGAGTATATGGG + Intergenic
911200103 1:95035973-95035995 GTATATTTTTAAATGTATGTTGG + Intronic
911448020 1:98023899-98023921 CTGTGTTTGTAATAGCATGTGGG - Intergenic
911618102 1:100037302-100037324 ATGTGTATGTATATGTAGGTGGG - Intergenic
911658650 1:100475306-100475328 GTGTCTTTGTAATTGTTTGTTGG + Intronic
911895251 1:103425388-103425410 ATGTGTTTATAAGTGTATATAGG + Intergenic
912163287 1:107012384-107012406 GAGTGTTTGGAAATGTATTTGGG - Intergenic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913443848 1:118928570-118928592 CTGTATATGTAAATGTTTGGAGG + Intronic
913470587 1:119181966-119181988 CTGTCTTTGTAGATGGATTTTGG + Intergenic
914930927 1:151932216-151932238 GTTTTTTTGTAAATGTCTGTAGG + Intergenic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
915048995 1:153048111-153048133 CTGTCATTAAAAATGTATGTGGG - Intergenic
915303816 1:154966539-154966561 CTGTGGCTGTAAATGTGTGGTGG + Intronic
915788879 1:158646110-158646132 CTGTGTGTGTATGTGTATGTTGG - Intronic
916764717 1:167849205-167849227 ATGTGTTTGTAACTGAGTGTGGG - Intronic
917082444 1:171270238-171270260 TTCAGTTTGTAAATGTAAGTGGG + Intronic
917638837 1:176962447-176962469 CTGTGTTCAAAATTGTATGTTGG + Intronic
918083238 1:181223419-181223441 GTGTGTGTGTATGTGTATGTGGG + Intergenic
918391661 1:184070244-184070266 GTGTGTTTGTATGTGTGTGTTGG - Intronic
918581179 1:186131755-186131777 CTGTGTGTGTAAATTTATGTAGG - Intronic
918923587 1:190749195-190749217 CTGTGTTTGCCAATGTAGGATGG - Intergenic
919213421 1:194518597-194518619 ATTTGTTTGTTAATGCATGTAGG + Intergenic
919368123 1:196691381-196691403 CTGTTGATATAAATGTATGTTGG - Intronic
919892492 1:201985604-201985626 CTGTGTGTATATGTGTATGTAGG - Intronic
921586532 1:216952987-216953009 CTGCATATGTATATGTATGTGGG + Intronic
921624800 1:217367460-217367482 CTGTGTGTATACGTGTATGTAGG - Intergenic
922284349 1:224155530-224155552 CTGTTTTTGCAAAAGTATATTGG + Intronic
924146780 1:241085011-241085033 CTGTGATTATAAAAGTCTGTAGG - Intronic
924187762 1:241513974-241513996 ATATGTGTGTATATGTATGTGGG - Intronic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1066441015 10:35438635-35438657 CTGTGGTTCTAAATGTATACAGG - Intronic
1066990493 10:42508775-42508797 CTGTACCTATAAATGTATGTGGG - Intergenic
1068455425 10:57249048-57249070 CTTTGTTTTTAAATCTATGATGG - Intergenic
1068599523 10:58941710-58941732 CTTTATTTTTAAATGTCTGTAGG - Intergenic
1068659566 10:59610068-59610090 CTTTGTTTATAAATATATGGAGG + Intergenic
1069718061 10:70533389-70533411 GTGTGTGTGTACCTGTATGTAGG + Intronic
1070361330 10:75692384-75692406 ATGTGTGTGTATATATATGTAGG - Intronic
1070361331 10:75692597-75692619 GTGTGTGTGTATGTGTATGTAGG + Intronic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1071449446 10:85780330-85780352 CTGGGTTTGTAAATCTGTGGGGG - Intronic
1071463679 10:85921023-85921045 CTGTGTTTGCCAATGTATCATGG - Intronic
1071641883 10:87316528-87316550 CTGTATTTCTACATGTATATAGG - Intergenic
1072375195 10:94808284-94808306 GTGTGTTTTTAAATGTTTCTGGG + Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073530115 10:104223070-104223092 CTGTTTTTGTAAAGTTTTGTTGG - Intronic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073741492 10:106412875-106412897 GGGTGTTTGTGAATGGATGTTGG + Intergenic
1073982416 10:109169556-109169578 CTGTGTAAGTTAATGTAAGTTGG - Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074337485 10:112592731-112592753 CTGATTGTGTAAATGTATATGGG - Intronic
1074441965 10:113485733-113485755 ATGTGTCTGTAAATATATCTTGG - Intergenic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074863800 10:117533284-117533306 GTGTGTGTGTGAATGTATTTGGG - Intergenic
1075483019 10:122798451-122798473 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1075564079 10:123491110-123491132 CTGCGTCTGTAAGTTTATGTGGG + Intergenic
1076247188 10:128956582-128956604 CTGTGTTTGTAAGTGCGTGCCGG - Intergenic
1076277162 10:129211060-129211082 CTGTGTTTTTAAAGATATGGTGG - Intergenic
1077381545 11:2243440-2243462 TTGTGTTTGTGAGTGTATTTAGG - Intergenic
1077418007 11:2434337-2434359 GTGTGTGTGTGAATGTGTGTAGG + Intergenic
1078042953 11:7884974-7884996 GTGTGTGTGTGAATGCATGTGGG + Intergenic
1078084684 11:8226589-8226611 ATGTGTTTTTAAATGTCTGGGGG - Intronic
1079087232 11:17455161-17455183 CTGTGGTTGGAAATTTATATGGG - Intronic
1079341585 11:19616234-19616256 CTGTGTTTGTAATTTAATGTGGG + Intronic
1080169662 11:29284656-29284678 ATATGTATGTAAATATATGTAGG + Intergenic
1081086148 11:38803905-38803927 CTTTCTTTGTAAATGTATGTGGG - Intergenic
1081170575 11:39865434-39865456 CTGTATTTTTAAATTTATATTGG + Intergenic
1084219564 11:67668993-67669015 CTGTGTGTGTATGTGTATATGGG + Intronic
1084230052 11:67745008-67745030 GTGTGTGTGTAAGTGTGTGTTGG - Intergenic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085365551 11:75939534-75939556 CTATGTATGTATATGTATGGGGG - Intronic
1085542187 11:77282045-77282067 ATGTGGTTGGAAAAGTATGTAGG + Intronic
1085591881 11:77770637-77770659 GTGTGTTTCTTTATGTATGTGGG - Intronic
1085734312 11:79025907-79025929 CTCTGCTTGTGAGTGTATGTGGG + Intronic
1087330906 11:96778605-96778627 CTGTGTTTTTAATTGTCTTTTGG - Intergenic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087762258 11:102112788-102112810 CATTGTGGGTAAATGTATGTTGG + Intronic
1088461064 11:110083378-110083400 TTGTGTCTTTAATTGTATGTTGG + Intergenic
1089098935 11:115944198-115944220 CTGAGTTTGGAAAAGGATGTTGG + Intergenic
1089323696 11:117643333-117643355 GTGTGTTTGTGTGTGTATGTGGG + Intronic
1089539094 11:119179225-119179247 CTGGGTTTGAAAATGTATCAGGG + Intronic
1089828475 11:121301922-121301944 CGGTGTTTGTTAATGTAAGATGG - Intronic
1090366406 11:126210510-126210532 GTGTGTGTGTGTATGTATGTTGG - Intronic
1091196978 11:133739375-133739397 GTGTGTTTGTGTATGTGTGTGGG + Intergenic
1091683858 12:2547543-2547565 CTGTGTGTGTAAATGCGTGTGGG + Intronic
1091739480 12:2950224-2950246 CTGTGTTGGAAAATGTTAGTTGG + Intergenic
1092130495 12:6109009-6109031 TTGAATTTGTAAATGTATATAGG + Intronic
1093472275 12:19515279-19515301 CTGTGCTTATGAAGGTATGTGGG + Intronic
1093837200 12:23847904-23847926 ATGTGTTTGTATATTTATGTAGG - Intronic
1094030601 12:26007576-26007598 CTGAGTTTGTAAAGGTGAGTGGG + Intronic
1094410804 12:30167170-30167192 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1097363950 12:58690639-58690661 CTGTGTTTGCAAATTTAGCTGGG + Intronic
1098373130 12:69780998-69781020 CTGTGTTCATAAATGTACTTGGG + Intronic
1098848933 12:75571529-75571551 ATGGGATTGTAATTGTATGTTGG - Intergenic
1098918082 12:76277785-76277807 CTGTGTCTGGAAAAGTAAGTTGG - Intergenic
1099963688 12:89421915-89421937 ATGTGTTTGTATATGTATTCTGG - Intronic
1100443079 12:94635638-94635660 CTGTTTTTGTGTGTGTATGTGGG + Intronic
1100691756 12:97045774-97045796 CTATGTGTGTAAACGTATGTAGG - Intergenic
1101264596 12:103070503-103070525 GTGTGTGTGTATGTGTATGTAGG - Intergenic
1101311563 12:103585355-103585377 CTGTTTTTGCAAATTTATATTGG - Intergenic
1101841986 12:108334333-108334355 CTGTGTGAATAAATGCATGTGGG - Intronic
1104053051 12:125209237-125209259 CTCTTTCTGTAAATGAATGTTGG + Intronic
1104214948 12:126726166-126726188 CTGTGTTTATAAATGTGTAGGGG - Intergenic
1104242768 12:127006902-127006924 ATGTGTGTGTAGATGTTTGTAGG - Intergenic
1104245564 12:127037834-127037856 GTGTGTGTGTATATATATGTTGG + Intergenic
1104579218 12:129997498-129997520 CTTAGTTTGTATATGAATGTAGG - Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1105405622 13:20129807-20129829 GTGTGTGTGTGAATGTGTGTGGG - Intergenic
1106516570 13:30460634-30460656 TTCAGTTTGTAAATGTAAGTGGG + Exonic
1106578530 13:30998538-30998560 TGGCGTTTGTAAATGTGTGTGGG - Intergenic
1106602896 13:31202261-31202283 CCGTGTCTGTATATGCATGTGGG - Intronic
1106887891 13:34209621-34209643 CTGTTTATGTAAATGTATTAGGG + Intergenic
1107260816 13:38488924-38488946 CTTTGTTTCTAAAAGGATGTAGG - Intergenic
1108034322 13:46272835-46272857 CTGTGTATGTATGTGTCTGTGGG - Intronic
1108187768 13:47905551-47905573 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1108260292 13:48649036-48649058 GTGTGTATGTATGTGTATGTGGG + Intergenic
1108425854 13:50299430-50299452 ATGTGTGTGTACATGTATATGGG - Intronic
1108769547 13:53681816-53681838 CTAAGTTTGTAAATGTCTGTTGG + Intergenic
1108959893 13:56213601-56213623 GTGTGTTTGTGTATGTGTGTGGG - Intergenic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109774458 13:67021902-67021924 ATGTGTATATATATGTATGTAGG + Intronic
1109884034 13:68519376-68519398 TTCCGTTTGTAAATGTATCTTGG + Intergenic
1110199102 13:72827711-72827733 TTTTGTTTCTACATGTATGTAGG + Exonic
1110294554 13:73848210-73848232 CTTGATTTGTAAATGTATGTAGG - Intronic
1110501031 13:76228597-76228619 CTGTTTTTGTAAAGGTTTATTGG + Intergenic
1110921538 13:81093525-81093547 GTGTGTGTGTGTATGTATGTTGG + Intergenic
1111356410 13:87109636-87109658 CTGTGTTTGTGTGTGTATGTGGG + Intergenic
1111518582 13:89367504-89367526 ATGTGTTTGTATGTCTATGTTGG - Intergenic
1111753560 13:92363800-92363822 CTGTATTTATAATTGTATGCTGG - Intronic
1112407479 13:99134146-99134168 GTGTGTTTGTAGATGCATGAAGG + Intergenic
1112718978 13:102220519-102220541 CAGTGTTTTGAATTGTATGTTGG - Intronic
1112885396 13:104164273-104164295 CTGTATTTTTAAATATATGATGG + Intergenic
1113327341 13:109294737-109294759 GTATGTATGTAAATGTATGTAGG - Intergenic
1113387761 13:109866181-109866203 CTTTTTTCGTAAAAGTATGTAGG - Intergenic
1113522699 13:110951911-110951933 CTCTATTTGGAAATGTGTGTTGG + Intergenic
1113546915 13:111159734-111159756 CTGAGTTTTTAAATATATTTTGG + Intronic
1114066736 14:19066334-19066356 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1114095530 14:19333693-19333715 CTGTGTTTGAACAGGTAGGTTGG - Intergenic
1114788302 14:25626268-25626290 CTGTGTGTGTATGTGTGTGTTGG + Intergenic
1114803450 14:25806015-25806037 CTGAGTTTGAGAATGTATGCAGG - Intergenic
1115107951 14:29783569-29783591 CTATTTTGGTAAATGTATGGAGG - Intronic
1115971129 14:38945911-38945933 CTGTGTTTGTGTATGTGTGGTGG - Intergenic
1118225635 14:63896509-63896531 CAGTGTTTGTAAATGCGTGGCGG + Intronic
1118323377 14:64766174-64766196 GTGTGTGTGTATGTGTATGTGGG + Intronic
1118499086 14:66340662-66340684 ATGTGTGTGTATATATATGTGGG + Intergenic
1119109260 14:71956400-71956422 GTGTGTGTGTATATATATGTAGG + Intronic
1119123578 14:72102303-72102325 TTGTTTATGTAAATGTATTTTGG - Intronic
1119827011 14:77665361-77665383 ATATGTTTGTAAATGCATGGGGG - Intergenic
1120168741 14:81227939-81227961 CTGTGTTGGTAATTGTTTCTAGG - Intergenic
1120465062 14:84845851-84845873 TTGTTTTTGAAAATGTATTTGGG - Intergenic
1120486851 14:85124904-85124926 GTGTGTGTGTGAATGTGTGTGGG - Intergenic
1120526442 14:85582256-85582278 ATGTGTTTGTATATGCATGCAGG + Intronic
1120747774 14:88167314-88167336 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1121563314 14:94890301-94890323 GTGGGTGTGTAAATGTGTGTGGG + Intergenic
1121569704 14:94937820-94937842 CTGTGTGTGTATATCTGTGTGGG + Intergenic
1121809917 14:96875929-96875951 GTGTGTGTATAAATGTATATAGG - Intronic
1123456691 15:20432767-20432789 CTGTTTTTGTAAATTTTTATGGG - Intergenic
1123661371 15:22567593-22567615 CTGTTTTTGTAAATTTTTATGGG + Intergenic
1124262837 15:28207909-28207931 CTGTTTTTGTAAATTTTTATGGG - Intronic
1124519855 15:30398642-30398664 GTGTGTGTGTATATGTATATGGG - Intergenic
1124538799 15:30567579-30567601 GTGTGTGTGTATATGTATATGGG + Intergenic
1124812402 15:32953927-32953949 CTCAGTTTAAAAATGTATGTGGG + Intronic
1125842506 15:42817326-42817348 CTGTATTTTAAAATGTAGGTAGG - Intronic
1126470137 15:49001249-49001271 CTGTTTTTGTAAATGACTGAAGG - Intronic
1126548928 15:49905947-49905969 GTGTGTGTGTATATATATGTAGG - Intronic
1126656493 15:50983394-50983416 AGGTGTTTGTAAATGTCTCTGGG + Intronic
1127270917 15:57401131-57401153 CTGTGTATATAAATTTTTGTTGG + Intronic
1128356683 15:66932875-66932897 CCGTGTGTGTGAATGCATGTGGG - Intergenic
1128871765 15:71164048-71164070 TTCAGTTTGTAAATGTAAGTGGG + Intronic
1128916538 15:71567789-71567811 GTGTGTTTGTAGGTGTGTGTGGG + Intronic
1129546924 15:76405848-76405870 CTGTGTTGGTAAATGAATAGTGG - Intronic
1129924506 15:79350913-79350935 CTGTGTTTAGAAATGTTTGATGG + Intronic
1130162695 15:81417406-81417428 GTGTGTATGTATATGTAAGTGGG - Intergenic
1130601923 15:85281441-85281463 GTGTGTGTGCATATGTATGTGGG - Intergenic
1130766986 15:86880733-86880755 GTGTGTGTGCATATGTATGTGGG + Intronic
1130836082 15:87651452-87651474 CTCTGTATGTACACGTATGTGGG + Intergenic
1131619833 15:94056232-94056254 CTGTGAGTGTCAATGTATTTGGG + Intergenic
1132126338 15:99228943-99228965 GTATGTGTGTATATGTATGTAGG - Intronic
1132406914 15:101547934-101547956 CTGTGTATATAATTATATGTTGG - Intergenic
1134437813 16:14277677-14277699 CTGTCTTTGTAGCTGTTTGTTGG - Intergenic
1134794102 16:17018828-17018850 CTGTGTCTGTACATCTACGTGGG + Intergenic
1135845394 16:25913902-25913924 ATGTGTGTGCATATGTATGTAGG + Intronic
1135845415 16:25914091-25914113 ATGTGTGTGTATGTGTATGTAGG + Intronic
1136744725 16:32575820-32575842 CTGTTTTTGGAAATCTATGAAGG + Intergenic
1137047021 16:35675288-35675310 CTGGGTTTGAAAAAGTATTTTGG + Intergenic
1137539293 16:49350954-49350976 GTGTGAGTGTAAATGTGTGTGGG - Intergenic
1137557436 16:49480235-49480257 ATGTGATTCTAAATGTGTGTAGG + Intergenic
1137633986 16:49969656-49969678 CTTTGCTTGGAAATGTCTGTTGG - Intergenic
1138242345 16:55437250-55437272 CTGTGTGAGTAAATGGATTTAGG + Intronic
1138885724 16:61075737-61075759 GTATGTGTGTATATGTATGTGGG - Intergenic
1139001311 16:62513514-62513536 GTATGTTTGTACATGTAAGTGGG - Intergenic
1140046691 16:71444239-71444261 GTGTGTGTGTCTATGTATGTGGG + Intergenic
1140268891 16:73445306-73445328 GTGTGTGTGTATATGTATGGGGG + Intergenic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141783399 16:86180774-86180796 GTGTGTATATAAATGCATGTGGG - Intergenic
1141888396 16:86909299-86909321 CTTTGTTTGTGAATGTGTATTGG - Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1203024872 16_KI270728v1_random:499408-499430 CTGTTTTTGGAAATCTATGAAGG - Intergenic
1203046849 16_KI270728v1_random:835023-835045 CTGTTTTTGGAAATCTATGAAGG + Intergenic
1142621796 17:1169950-1169972 CTGTGTTTGTGTTTGTATGGGGG + Intronic
1143683341 17:8493999-8494021 CTGTGTTTGTTAATGTCACTGGG - Intronic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144461902 17:15465122-15465144 CTGTGTTTGTATCTGTGTGTTGG - Intronic
1145769171 17:27479923-27479945 GGGTGTGTGTGAATGTATGTAGG + Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1147601534 17:41749093-41749115 ATATGTTTGTGTATGTATGTTGG - Intergenic
1148682076 17:49479944-49479966 CTGTGTGTGTTTATGTGTGTTGG - Intergenic
1151177988 17:72304970-72304992 GTGGGTGTGTAAATGTATGTTGG + Intergenic
1151497143 17:74465154-74465176 GTGAGTTTGTGAATGTGTGTGGG + Intergenic
1151497146 17:74465252-74465274 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497156 17:74465638-74465660 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497161 17:74465754-74465776 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497163 17:74465804-74465826 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497165 17:74465858-74465880 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497167 17:74465906-74465928 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151741641 17:75986877-75986899 ATGTGTTTGTATATGTGGGTGGG + Intronic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1152770425 17:82164615-82164637 ATGAGTTTTTAAATGTCTGTGGG - Intronic
1153328214 18:3843704-3843726 CTGTCTTTGTAAAACTATATTGG - Intronic
1153489992 18:5636951-5636973 CTGTGTTTGGAAATATTTCTAGG - Intergenic
1153927825 18:9849953-9849975 CTTTTTTTGTAAATGTAAATTGG - Intronic
1154351908 18:13590310-13590332 GTGTGTTGGTATGTGTATGTGGG + Intronic
1154369859 18:13750159-13750181 CTGTGTTTTTAAGGGTATGCTGG - Intronic
1154392584 18:13953100-13953122 ATGTGTTTGTACAGGTATGAGGG + Intergenic
1154471942 18:14712147-14712169 TTATGTATGTAAATGTATTTTGG + Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155139395 18:23030353-23030375 ATGTATTTTTAAATGTATGTAGG + Intergenic
1155234691 18:23807490-23807512 CTGTGTGTGTATGTGTGTGTAGG + Intronic
1155828347 18:30478964-30478986 TTTTGTTTGTCAGTGTATGTGGG - Intergenic
1156020095 18:32589606-32589628 GTGTGTTTGTAATTACATGTTGG - Intergenic
1156570105 18:38243252-38243274 GTGTGTTTCTAAATGAATATAGG + Intergenic
1156876888 18:42025110-42025132 CTGTTATTGAAAATATATGTTGG - Intronic
1157030543 18:43901728-43901750 CTTTATTTGTAAATTTATTTTGG + Intergenic
1157300488 18:46475330-46475352 GTGTGTGTGTACATGAATGTGGG - Intergenic
1159271313 18:66155217-66155239 GTGTCTTTGGAAATTTATGTTGG - Intergenic
1159677215 18:71299819-71299841 CTGTGTGTATATATGTGTGTGGG + Intergenic
1160209486 18:76864498-76864520 ATGTGTGTGTAAATATTTGTTGG - Intronic
1160699608 19:499509-499531 CTGTGTTTGTACACGCGTGTGGG - Intronic
1160829744 19:1098209-1098231 CTGTGTTGGGAAATGACTGTTGG + Intergenic
1161876152 19:6911842-6911864 GTATGTGTGTAAATGTGTGTGGG - Intronic
1161876155 19:6911871-6911893 GTATGTGTGTAAATGTGTGTGGG - Intronic
1161876158 19:6911896-6911918 GTATGTGTGTAAATGTGTGTGGG - Intronic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1162530418 19:11232854-11232876 CTGTGTATGTATATGCATGGGGG + Intronic
1162751481 19:12832699-12832721 CTGTCTCTGTATATGTTTGTCGG - Intronic
1162861858 19:13511850-13511872 AGGTGTTTGCAAATGTATGTGGG - Intronic
1164565102 19:29320172-29320194 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1164827623 19:31296133-31296155 GTGTGTGTGTGATTGTATGTGGG + Intronic
1164882638 19:31747246-31747268 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164882647 19:31747558-31747580 GTGTGTGTGTAGATATATGTAGG + Intergenic
1166026089 19:40086223-40086245 CTATGTTTTTCTATGTATGTTGG + Intronic
1167881065 19:52457702-52457724 CTCTGTGACTAAATGTATGTGGG - Intronic
1168159102 19:54496932-54496954 ATGTGTGTGTATATATATGTAGG - Intergenic
925521004 2:4745931-4745953 CTGTGTGTGTATAGGTATGCAGG - Intergenic
926293316 2:11548383-11548405 ATGTGTATGTGTATGTATGTGGG - Intronic
926705260 2:15833100-15833122 ATGTGTGTGTTTATGTATGTGGG + Intergenic
927415588 2:22876731-22876753 CTGTGATTATATTTGTATGTTGG - Intergenic
927577789 2:24214225-24214247 CTGTATTTGTAAATGATAGTGGG + Intronic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929259236 2:39845962-39845984 GTGTGTGTGTGTATGTATGTGGG + Intergenic
929423237 2:41816510-41816532 TTGTGTGTGTATATATATGTGGG - Intergenic
929949161 2:46393202-46393224 CTGTGAGTGTGCATGTATGTTGG - Intergenic
930073257 2:47385737-47385759 GTGTCTTTGTAGTTGTATGTGGG + Intronic
930214199 2:48677019-48677041 CTGCATTTCTAAATGTATTTGGG + Intronic
930320810 2:49852721-49852743 TTGTGTTTTAAAATGTATGCTGG - Intergenic
930416731 2:51098468-51098490 TTGTGTTTGTAAATGAAAGAGGG - Intergenic
930994643 2:57701642-57701664 TTTTGTTTGTAAATGTTTATCGG + Intergenic
931540039 2:63320936-63320958 CTGTGTTTGTATATTTATAGTGG - Intronic
932589541 2:73056193-73056215 ATGTATTTACAAATGTATGTAGG - Intronic
932784026 2:74583787-74583809 CTGTGTTGGAACAAGTATGTTGG - Intronic
932987354 2:76742137-76742159 ATGTGTTCCTAAATGTATTTTGG + Intergenic
933591673 2:84239855-84239877 CTGTGTTAGTCAAGGTAGGTTGG + Intergenic
933605030 2:84373744-84373766 ATGTGTTTGTGTATGTAAGTTGG - Intergenic
934053453 2:88230774-88230796 GTGTGTTTGTAATTGCTTGTTGG + Intergenic
934154877 2:89188687-89188709 TTGTGATTGTAAAAGAATGTTGG + Intergenic
934212440 2:89994036-89994058 TTGTGATTGTAAAAGAATGTTGG - Intergenic
934928532 2:98399975-98399997 GTGTGTATGTATATATATGTTGG + Intergenic
935263251 2:101373022-101373044 CTGTTTTCCTAAATGTATGAGGG - Intronic
935572907 2:104680500-104680522 CTGTCTTTTTAAATTTATCTTGG + Intergenic
935734529 2:106096194-106096216 GTGTGTGTGTGTATGTATGTGGG + Intronic
935748551 2:106210557-106210579 CTGTCTTTGTAGATGGATTTTGG - Intergenic
936745016 2:115565141-115565163 ATGTGTGTATATATGTATGTAGG + Intronic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
937950309 2:127381535-127381557 CAGTGTTAATAAATGTTTGTTGG - Intronic
938223248 2:129590617-129590639 CTATTTTTGTAAATGAATGCAGG - Intergenic
938484133 2:131686428-131686450 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
939070666 2:137537469-137537491 CTGAGTTTGTGAATGCCTGTAGG + Intronic
939370162 2:141288960-141288982 GTGTGTTTGTACATGTACTTTGG + Intronic
939447667 2:142331401-142331423 CTATGTTTTCAAATGTATTTGGG + Intergenic
939853993 2:147334761-147334783 CTGTGTGTGTGAGAGTATGTGGG + Intergenic
939949215 2:148448380-148448402 CTGTGTCTGAATATGTATCTAGG - Intronic
940608854 2:155964461-155964483 GTGTGTTTGTGTTTGTATGTGGG - Intergenic
940628357 2:156206083-156206105 GAGTGTTTGTAAATGTATTGTGG - Intergenic
941416237 2:165224760-165224782 ATATGTATGTAAGTGTATGTGGG + Intergenic
941421371 2:165286514-165286536 ATGTGTTTGACATTGTATGTTGG + Intronic
941469420 2:165865874-165865896 CTGTATATGCATATGTATGTAGG + Intronic
941620281 2:167770074-167770096 CTGTGTTTGTATGTTTATTTAGG + Intergenic
941734237 2:168955662-168955684 CTGTGTTTTGAAATGTAAGAAGG - Intronic
941878886 2:170461818-170461840 GTGTGTATGTATATGTATGGAGG + Intronic
942795809 2:179817789-179817811 CTGTGTGTGTGCATGCATGTTGG + Intronic
944278458 2:197867024-197867046 CTGTGTTTGCTAATGCATCTCGG - Intronic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
945928836 2:215833995-215834017 CAGTGTTTATATAAGTATGTTGG + Intergenic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
946505918 2:220300671-220300693 CTGTCTTTTTAAATATATGGAGG + Intergenic
947342745 2:229157049-229157071 TTGTGTGTGTATATGTATGCCGG - Intronic
947699894 2:232224190-232224212 ATGTGGTTGTATATATATGTGGG - Intronic
948640280 2:239371578-239371600 GAGTGTTTGTGAATGTCTGTGGG - Intronic
949073411 2:242040270-242040292 GTGTGTCTGTAACTGTACGTGGG - Intergenic
1169277333 20:4242870-4242892 GTGTGTTTGTGTGTGTATGTAGG + Intronic
1169291540 20:4357442-4357464 CTGTGTTTGTAAAGCTTTGTTGG + Intergenic
1169354088 20:4893416-4893438 CTCTTTCTGTATATGTATGTTGG - Intronic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1170260600 20:14402541-14402563 GTGTGTTTGTGTATGTCTGTGGG + Intronic
1170828927 20:19822667-19822689 CTGAATTTGTAATTGTGTGTGGG - Intergenic
1171051467 20:21863074-21863096 GTGTATTTGTACATGTGTGTGGG + Intergenic
1172800676 20:37574185-37574207 GCGTGTTTGCAAATGTGTGTGGG + Intergenic
1173174645 20:40755048-40755070 CTGTATTGGGAAATGTATTTGGG - Intergenic
1173191244 20:40877156-40877178 CTGAGTTTCTAAATCTCTGTGGG - Intergenic
1173410657 20:42806721-42806743 CTGTTTTTGTAAAGCTTTGTTGG - Intronic
1173547404 20:43909452-43909474 GTGTGTGTGTGTATGTATGTAGG + Intergenic
1173850945 20:46217417-46217439 GTGTGTGTGTGAATGTATCTGGG - Intronic
1174293204 20:49523924-49523946 CTGTGTGTGCATGTGTATGTAGG - Intronic
1174644448 20:52073384-52073406 GTGTATTTGTAAAAGTCTGTGGG - Intronic
1174657807 20:52186237-52186259 CTGTGTGTGTAGGTGTTTGTGGG + Intronic
1175391405 20:58629821-58629843 ATGTTTTTGTAAAATTATGTGGG + Intergenic
1176802552 21:13445742-13445764 TTATGTATGTAAATGTATTTTGG - Intergenic
1177018408 21:15819864-15819886 TTTTGTTTGTTTATGTATGTGGG - Intronic
1177079471 21:16620609-16620631 GTGTGTTTGTGAGTGTGTGTAGG + Intergenic
1178145918 21:29739812-29739834 GTGTATTTTTAAATGGATGTTGG - Intronic
1178160592 21:29908569-29908591 TTGATTTTGAAAATGTATGTTGG - Intronic
1178247882 21:30971629-30971651 GTGTGTTTGTGTGTGTATGTGGG + Intergenic
1178429623 21:32508045-32508067 CTGTGTGTGTAAGTGTGTGTTGG + Intronic
1179679759 21:43010944-43010966 CAGTGTTTGTAAAGGTCCGTAGG + Intronic
1180485218 22:15788918-15788940 CTGTGTTTGAACAGGTAGGTTGG + Intergenic
1180962609 22:19768791-19768813 CAGTGTTTGTAAATGAGGGTGGG + Intronic
1183906268 22:41042940-41042962 ATGTGTGTGTATATATATGTGGG + Intergenic
1184491709 22:44813561-44813583 GTGTGTGTGTAGTTGTATGTAGG - Intronic
1184491727 22:44813772-44813794 ATGTGTGTGTAGGTGTATGTAGG - Intronic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
949499878 3:4669545-4669567 ATGTCTTGGTAAAGGTATGTTGG + Intronic
949646625 3:6102538-6102560 CTGTGGCTGCACATGTATGTAGG - Intergenic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
951530865 3:23696823-23696845 CTGCATTTTTAAATTTATGTTGG - Intergenic
951702574 3:25511070-25511092 CTGTGTTTGTAAAGTTTTATTGG - Intronic
952339852 3:32436450-32436472 CTGCATTTGTAAATGTTAGTGGG - Intronic
952579576 3:34816499-34816521 CTGTTTTTGGAAATGTAAATTGG - Intergenic
952594748 3:35002568-35002590 CTATATATTTAAATGTATGTAGG - Intergenic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
953058891 3:39410571-39410593 CTGTCTTTTTTAATGTATGCAGG + Intronic
953252526 3:41259677-41259699 CTGTATTTGTAAATGTTTTTTGG + Intronic
953902905 3:46853304-46853326 CTGTGTCTGTAAGTGAATGTGGG - Intergenic
954309573 3:49754876-49754898 CTGAGGTTGTAAAAATATGTTGG - Intronic
954426962 3:50448409-50448431 GTGTATCTGTACATGTATGTAGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG + Intergenic
955162949 3:56483110-56483132 ATGTATTTGTAACTGTGTGTGGG + Intergenic
955471680 3:59293227-59293249 CAGAGTTTGTAAATAGATGTTGG + Intergenic
955805628 3:62731049-62731071 TAGTCTTTGTAAATCTATGTTGG + Intronic
955990444 3:64621459-64621481 CTTTATTTGTAAAAGTAGGTAGG + Intronic
956680127 3:71771189-71771211 CTGTGTTTGGAAATGGTTGGTGG + Intergenic
957046626 3:75379870-75379892 CTGTGTGTGTAAGTGTGTGTTGG - Intergenic
957561136 3:81822516-81822538 CTGTTTGTGTATGTGTATGTAGG - Intergenic
957590024 3:82184851-82184873 GTGTGTTTGTGTGTGTATGTTGG + Intergenic
957809280 3:85197259-85197281 CTGTGTTTATAAAATTATGTAGG - Intronic
958127256 3:89372396-89372418 CTGTGTTTTTAAAAATATCTTGG - Intronic
958482992 3:94668063-94668085 ATTGTTTTGTAAATGTATGTTGG - Intergenic
958506971 3:94992240-94992262 GTGTGTCTGTATATGTATGTGGG + Intergenic
958700944 3:97588562-97588584 AGGAGTTTGTATATGTATGTGGG + Intronic
959360906 3:105390358-105390380 CTTTGTTTATATATGTTTGTTGG + Intronic
959498907 3:107082596-107082618 CTGGGTTTCTAAATGAAGGTTGG + Intergenic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
959787124 3:110313087-110313109 ATGTGTGTTTAAGTGTATGTTGG - Intergenic
960774570 3:121234702-121234724 CGGTGTTTGGAAAGGGATGTAGG + Intronic
962054836 3:131860138-131860160 CTGTGTCTGTAAAGTTATGTTGG + Intronic
962236049 3:133708379-133708401 CAGTGTATGTAAATATATGTGGG + Intergenic
962669243 3:137688340-137688362 CTGTATTTGCAAATAAATGTAGG + Intergenic
963145919 3:141994163-141994185 TTGTGTTTGTACATGTGTGTAGG + Intronic
963332011 3:143925127-143925149 CTGTGTGTGTATGTGAATGTGGG - Intergenic
963789005 3:149564142-149564164 CTGTGTCAGTAAATGTAGGGTGG - Intronic
964005582 3:151823341-151823363 TTGTGTGTGTATATATATGTGGG + Intronic
964896792 3:161607271-161607293 CTGTGTTTGTAAAGTTGTATGGG + Intergenic
965581519 3:170273264-170273286 GTGTCTTTGGAAATGTTTGTAGG + Exonic
966326085 3:178756208-178756230 ATGTGTGTGTATATATATGTGGG + Intronic
967290364 3:187913918-187913940 ATGTGTTTGTGTATGCATGTAGG + Intergenic
967654399 3:192029470-192029492 CTGTGTTTTTATATGTAAGGTGG - Intergenic
968990918 4:3910981-3911003 CTTTGTGTGTAAGTGTGTGTTGG - Intergenic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
969824428 4:9746373-9746395 CTGTGTGTCTAAGTGTGTGTTGG + Intergenic
970187824 4:13481586-13481608 CAGTGTTTGTAAATGTAGCATGG - Intronic
970651925 4:18188229-18188251 GTGTGTGTGTCCATGTATGTGGG + Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
970703414 4:18770621-18770643 CTGTTTTACTAAATGTAAGTTGG + Intergenic
971154902 4:24071207-24071229 GTGTGTTTGTGCATGCATGTGGG - Intergenic
972516426 4:39814282-39814304 GTGTGGTTGTGATTGTATGTGGG + Intergenic
972753945 4:42024661-42024683 CTGTGATTGTAAATGTAAATTGG - Intronic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
973050043 4:45585335-45585357 CAGCAGTTGTAAATGTATGTGGG + Intergenic
974375134 4:61066380-61066402 TTGTTTTTTTAAAGGTATGTGGG - Intergenic
974571787 4:63660918-63660940 CTGTGTTTGTGTGTGTCTGTCGG + Intergenic
974856069 4:67462538-67462560 CTATTTTTGTATATGTTTGTGGG - Intergenic
974881093 4:67757994-67758016 ATGTGTATGAAAATGTATTTGGG + Intergenic
975293021 4:72699474-72699496 GTGTGTGTGTGTATGTATGTTGG - Intergenic
975400720 4:73935520-73935542 CTGTGTGTATATATGTATATAGG + Intergenic
975593271 4:76021434-76021456 ATGTGTTTGGAATTGTATGTAGG + Exonic
975920108 4:79376030-79376052 ATGTATGTATAAATGTATGTAGG + Intergenic
976093744 4:81485689-81485711 GTGTGTTTGGAGATGTATTTGGG + Intronic
976660085 4:87531777-87531799 CTTTATTTGGAAATGTTTGTTGG + Intergenic
977132967 4:93266469-93266491 CTGTGTGTGTATGTGTGTGTGGG - Intronic
977891560 4:102318155-102318177 CTTTTTTTCTAATTGTATGTAGG - Intronic
979122107 4:116916579-116916601 CTGTGTTTGTATATGTGTTTAGG + Intergenic
979535420 4:121814425-121814447 TTGTGTGTGTGTATGTATGTGGG + Intronic
979701861 4:123677670-123677692 TTTTTTTTGTAAATGTAAGTTGG + Intergenic
979854430 4:125613381-125613403 CTGTGTGTGTATGTGTATGTGGG - Intergenic
979939419 4:126741423-126741445 GTGTGTTTGTATATGTGGGTGGG - Intergenic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
980385517 4:132084762-132084784 CTTTATTTGGAGATGTATGTGGG - Intergenic
980695319 4:136347997-136348019 GTGTGTTTGTGTGTGTATGTGGG - Intergenic
980847955 4:138346612-138346634 CTGTATTTGGAAATATATTTTGG - Intergenic
982672753 4:158341581-158341603 CTGTGTGTGTATACATATGTGGG - Intronic
982840079 4:160173456-160173478 GTGTGTTTGTGTATGTGTGTTGG + Intergenic
983280132 4:165670321-165670343 CTGTGTGTGTATGTGTGTGTAGG + Intergenic
983305165 4:165975437-165975459 AATTGTTTGTAAATGTATCTAGG - Intronic
983983801 4:174032902-174032924 ATGTGTTTGTATATCTTTGTAGG - Intergenic
985074428 4:186199062-186199084 CACTGTTGGTAAAAGTATGTAGG - Exonic
985826501 5:2195514-2195536 CTGTTTTTGAAAATGGATTTTGG + Intergenic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
986106080 5:4661014-4661036 AAATGTTTGGAAATGTATGTGGG - Intergenic
987505128 5:18759232-18759254 GTGTGTGTGTATGTGTATGTGGG + Intergenic
987790282 5:22557275-22557297 ATTTGTTTGTAAATGTTTGCAGG - Intronic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
988016461 5:25566183-25566205 CTGTCTTTGTATGTGTATGAGGG + Intergenic
988700740 5:33672128-33672150 ATGTGTGTGTGTATGTATGTGGG - Intronic
988736880 5:34031488-34031510 TTTTGTTTGTAAATTTATATTGG + Intronic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
991267125 5:64733363-64733385 GTGTGTGTGTATATATATGTGGG - Intronic
991393069 5:66170459-66170481 ATGTATATGTAAATGTCTGTAGG + Intronic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
992763571 5:79973691-79973713 ATGTGTTTGGAAATGTGTGGTGG - Intergenic
993100011 5:83526444-83526466 CTGTGTTGGTTAATGTTTGAGGG + Intronic
993298692 5:86179042-86179064 TTGTGTTTAAAAATGTATTTTGG - Intergenic
993665648 5:90692442-90692464 CTGGGTTTGTAAGTGTAATTGGG + Intronic
993831142 5:92759597-92759619 TTGTGTGTGTATATGTGTGTTGG + Intergenic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
995026051 5:107424085-107424107 CTGTGTTTGTATCTGAATTTTGG + Intronic
995159064 5:108954089-108954111 ATGTGTTTGTAATTGCATGTTGG + Intronic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
995576792 5:113545299-113545321 TTCTCTTTGTAAATGTGTGTTGG + Intronic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
996249480 5:121311322-121311344 CTATGTGTGTGTATGTATGTGGG + Intergenic
997487230 5:134241652-134241674 GTGTGTGTGTATATATATGTGGG + Intergenic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
999565851 5:152860550-152860572 GTGTGGTTTTAAATGTATATAGG + Intergenic
999966356 5:156813977-156813999 CTGTGTTTTCACATGTATTTAGG - Intergenic
1000367380 5:160504414-160504436 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1000509012 5:162158906-162158928 CCGTGTGTTTAAATATATGTGGG - Intergenic
1000584471 5:163079765-163079787 ATGTGTGTGTACATATATGTGGG + Intergenic
1000977977 5:167785701-167785723 CTGAATTTGTAAATTTATTTTGG - Intronic
1001001648 5:168013101-168013123 ATGTGTGTGTAAGTGTGTGTTGG - Intronic
1002394917 5:178945228-178945250 CTGTGTGTGTATTTGTATGTTGG + Intronic
1002669325 5:180853170-180853192 CTGTGCTTGGAGATTTATGTAGG - Intronic
1003207942 6:4030669-4030691 CTGTTAATGTAAATGTATTTTGG + Intronic
1003721351 6:8706226-8706248 GTGTGTGTGTAAGTATATGTAGG - Intergenic
1005536495 6:26762465-26762487 ATGCATGTGTAAATGTATGTGGG - Intergenic
1005639641 6:27783736-27783758 CAGTTTTTGAAAATGTAGGTTGG - Intergenic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1007724977 6:43910363-43910385 CTGTGTTAATATATGTTTGTGGG - Intergenic
1008698073 6:54064952-54064974 CTGTGGTTGTTGTTGTATGTTGG - Intronic
1009007397 6:57804846-57804868 ATGCATGTGTAAATGTATGTGGG - Intergenic
1010045814 6:71442128-71442150 CTGTGGTTATAAATATATGATGG + Intergenic
1010336256 6:74686906-74686928 CTGATCTTCTAAATGTATGTAGG + Intergenic
1011171972 6:84515042-84515064 CTGTGTTTATAAAGTCATGTAGG + Intergenic
1011606440 6:89110791-89110813 ATGTTTTTGGAAATGTAAGTTGG - Intronic
1011610257 6:89143935-89143957 CTGTGTTAATAAATATTTGTTGG - Intergenic
1012272154 6:97226699-97226721 GTGTGTATATATATGTATGTAGG + Intronic
1012517651 6:100081375-100081397 TTGTATTTGTGCATGTATGTGGG + Intergenic
1013534862 6:111054666-111054688 GTGTGTGTGTATATGTATATTGG - Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1014499480 6:122167487-122167509 CTATGTGTGTATATGTGTGTTGG + Intergenic
1014681942 6:124441960-124441982 ATGTGTATGTAAATGTACATGGG - Intronic
1014839465 6:126200852-126200874 CTTTATTTATAAATGCATGTCGG - Intergenic
1016555922 6:145338300-145338322 CTAGAATTGTAAATGTATGTGGG - Intergenic
1016879019 6:148891982-148892004 CTGTTTTGCTAAATGAATGTGGG - Intronic
1017715065 6:157204230-157204252 CTGTGTGTGTATGTGTATATGGG + Intronic
1018455003 6:163943950-163943972 CTGTCTTTTTAAATCTCTGTTGG + Intergenic
1018462668 6:164013781-164013803 CTGTTCTTGGAAATGTATCTTGG + Intergenic
1018541562 6:164885488-164885510 CTGTGTTTGTATGTATGTGTAGG - Intergenic
1018683493 6:166284010-166284032 CAGTGTTTGTCAATTTCTGTGGG + Intergenic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1019282680 7:208197-208219 GTGGGTGTGTAAATGTAGGTTGG + Intronic
1020313738 7:6889087-6889109 GTGTGTGTGTAAGTGTGTGTTGG - Intergenic
1021194695 7:17662399-17662421 GTGTGTGTGTAGGTGTATGTGGG - Intergenic
1022103215 7:27181274-27181296 CTGTGTTAAGAAATGTCTGTTGG - Intergenic
1022417957 7:30194469-30194491 ATGTGTTTGTACAGGTGTGTAGG + Intergenic
1023459163 7:40375878-40375900 CTGTGTTTGTGAATGAATGGAGG + Intronic
1023765704 7:43508577-43508599 GTGTGTGTGTATGTGTATGTGGG - Intronic
1023810700 7:43909193-43909215 GTGTGTTTGTGTATGTGTGTAGG - Intronic
1023847223 7:44129213-44129235 CTGTGTGTGTATGTGCATGTGGG - Intergenic
1024015671 7:45312050-45312072 GGGTGTTTGTAAATGTGTGGTGG + Intergenic
1024352725 7:48383349-48383371 GTGTGTGTGCATATGTATGTGGG + Intronic
1024836762 7:53529701-53529723 CTGTTTTCCTAAATGTATTTTGG + Intergenic
1026029311 7:66776095-66776117 CTGTCTTTGAAAATTTATGTTGG + Intronic
1027493742 7:78861489-78861511 CTGTGTGTCTAATTGTATGGGGG - Intronic
1027548839 7:79565054-79565076 GTGTGTGTGTATGTGTATGTTGG + Intergenic
1028110793 7:86938761-86938783 TTTTCTTTCTAAATGTATGTTGG - Intronic
1028310864 7:89334087-89334109 CTATGGTTGTAAATGTTTGGTGG - Exonic
1028686322 7:93592252-93592274 GTGTCTTTGTAAATGAATGTGGG + Intronic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1030545570 7:110890964-110890986 GTGTGTGTGTATATGTATTTGGG - Intronic
1030682192 7:112445634-112445656 CTGTGTTTTTAATTGAATGAGGG - Intronic
1030909747 7:115232356-115232378 CTGTGTTGGTAAATTAATTTGGG + Intergenic
1031014763 7:116561279-116561301 ATGTGTTTGTATGTGTTTGTGGG + Intergenic
1031814741 7:126419905-126419927 CTGTGTGTGTCTATGTGTGTGGG - Intergenic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1032023377 7:128422278-128422300 ATGTGTGTGTAAGTGTGTGTAGG + Intergenic
1032725532 7:134587052-134587074 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1033117376 7:138637529-138637551 GTGTGTGTGTGTATGTATGTAGG - Intronic
1033590766 7:142806311-142806333 CTCTGGTTATAAATGAATGTGGG + Intergenic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1033666429 7:143445084-143445106 CTGTATTTGTTAAGGTCTGTGGG + Intergenic
1033828955 7:145228822-145228844 ATGTGTGTATACATGTATGTGGG - Intergenic
1034248969 7:149672915-149672937 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1035330286 7:158092276-158092298 GTGTGTGTGTATATATATGTAGG + Intronic
1035704259 8:1663073-1663095 GTGCGTTTGTACATGTGTGTGGG + Intronic
1035925695 8:3725508-3725530 GTGTGTGTGTATGTGTATGTGGG + Intronic
1036100504 8:5777519-5777541 CTGTGTTTCCAAAAGTATTTGGG + Intergenic
1036278520 8:7378674-7378696 CTGGCTTTGAAAATGTATGAAGG - Intronic
1036279771 8:7390878-7390900 CTGTGTGTGTAAATGGAGGTAGG - Intergenic
1036341748 8:7921005-7921027 CTGTGTGTGTAAATGGAGGTAGG + Intergenic
1036343003 8:7933212-7933234 CTGGCTTTGAAAATGTATGAAGG + Intronic
1036548529 8:9795868-9795890 CTGTGTGTTTAGTTGTATGTGGG - Intergenic
1037168714 8:15863551-15863573 GTGTGTTTGCATTTGTATGTAGG + Intergenic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1037436762 8:18871151-18871173 CTGTGTTCATACATGTATGTCGG + Intronic
1038036075 8:23688015-23688037 GTGTGTTTGAAAATGTATCTGGG + Intergenic
1038634614 8:29275567-29275589 GTGTCTTTGTATATGGATGTAGG - Intergenic
1039784451 8:40820789-40820811 CTGTGTGTGTATATATGTGTGGG + Intronic
1039784895 8:40825533-40825555 CTCTGTTTGCAAATGTAGGAGGG - Intronic
1040628887 8:49185257-49185279 CTGTGATGGTAAATGTATGATGG - Intergenic
1040778433 8:51075698-51075720 ATATGTTTGTAAATGCATATGGG - Intergenic
1042074613 8:64978221-64978243 CTGTGTGTGAAAATGCATTTTGG + Intergenic
1042181327 8:66090629-66090651 GTGTGGTTGTGAATGTATTTGGG - Intronic
1042443767 8:68859923-68859945 CTGTGGTTGTGAATTTAGGTTGG + Intergenic
1042523520 8:69740513-69740535 CTGTGTGTGTGTTTGTATGTGGG + Intronic
1042632598 8:70835770-70835792 CTCTGTTTATAAATGTATAGTGG - Intergenic
1042949625 8:74187522-74187544 CTGTGTTTGTAAATGATTTGGGG - Intergenic
1043126543 8:76403684-76403706 GTGTGTGTGCATATGTATGTGGG - Intergenic
1043362199 8:79487115-79487137 ATGTGTTTGTGATTGCATGTAGG - Intergenic
1043669626 8:82865821-82865843 ATGTGTTTGCAAATATATCTTGG + Intergenic
1043880676 8:85539195-85539217 GTGTGTTTGCATCTGTATGTGGG - Intergenic
1043889560 8:85641714-85641736 CTGATTTTATAAATGTGTGTGGG - Intergenic
1044277089 8:90313953-90313975 CTGGATTTCTAAATGTATGATGG - Intergenic
1044526469 8:93257666-93257688 TTGTATTTGTAAATGTTTATGGG + Intergenic
1045878386 8:107009772-107009794 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1045955822 8:107905395-107905417 GTGTGTTTATATATGTATGTAGG - Intronic
1046141190 8:110094971-110094993 ATGTGATTGTGTATGTATGTGGG - Intergenic
1047126227 8:121964261-121964283 CTCTGTTTTTGTATGTATGTAGG + Intergenic
1047617801 8:126577437-126577459 GTGTGTGTGTATATGTGTGTTGG - Intergenic
1048852848 8:138661063-138661085 GTGTGTATGTATGTGTATGTGGG - Intronic
1048859560 8:138714027-138714049 CTGTTTTTGTAAAAGAAGGTTGG + Intronic
1048885773 8:138908211-138908233 CCATGTTTGTAAATATGTGTTGG + Intronic
1048994902 8:139788263-139788285 ATGTGTGTGTCAGTGTATGTTGG + Intronic
1049351306 8:142166264-142166286 CTGAAATTGTAAATGCATGTGGG + Intergenic
1050349694 9:4728974-4728996 GTGTGTGTGTATATATATGTAGG - Intronic
1050391036 9:5144733-5144755 CTGTCTTTTTAAATCTTTGTTGG + Intronic
1051923996 9:22300756-22300778 GTTTGTCTCTAAATGTATGTAGG + Intergenic
1052539350 9:29787993-29788015 CTTTTTTTTTAAATGTATGTGGG - Intergenic
1052617826 9:30865198-30865220 CTGTATTTAAAAATGTATATGGG - Intergenic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1054849773 9:69835842-69835864 CTGTGGTTGTATGTTTATGTGGG - Intronic
1055111585 9:72565567-72565589 GTGTGTGTGTATGTGTATGTTGG + Intronic
1055196122 9:73596342-73596364 CTTTGTGTGTATATGTGTGTAGG - Intergenic
1055485300 9:76750571-76750593 CTGACTTTGTAAATGCATCTTGG - Intronic
1056019096 9:82423066-82423088 CTGAGTTTGCAAATCTATCTTGG + Intergenic
1056234884 9:84585029-84585051 CTTTATTTGTAATTGTAAGTTGG + Intergenic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1056910306 9:90694370-90694392 GTGTGACTGTAAATGTGTGTGGG + Intergenic
1057747822 9:97765878-97765900 CTGTGTCTGTAAGTGTATGATGG + Intergenic
1058855484 9:109057859-109057881 ATGTCTTTGCAAATGTATTTAGG - Intronic
1059967445 9:119629315-119629337 GTGTGTGTATAAATGTATATGGG + Intergenic
1060034896 9:120246705-120246727 GTGTGTTTTTATATGTATTTTGG - Intergenic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1062187489 9:135225715-135225737 GTGTGTGTGTGAGTGTATGTGGG - Intergenic
1062187511 9:135226269-135226291 GTGCGTGTGTGAATGTATGTGGG - Intergenic
1185480183 X:440266-440288 GTGTGTCTGTATATGTCTGTGGG - Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185754145 X:2639905-2639927 ATGTGTTTGTGTATGTGTGTAGG - Intergenic
1187028221 X:15457841-15457863 CTGTTTTTGTAAAAGTTTATTGG + Intronic
1187840672 X:23484064-23484086 GTGTGTTTGTATATATATGGGGG - Intergenic
1188561999 X:31479290-31479312 CTGTGTTTGTAAAGCTATTCTGG + Intronic
1189050410 X:37639236-37639258 GTATGTGTGTATATGTATGTAGG - Intronic
1189549228 X:42076027-42076049 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1190002662 X:46704565-46704587 CTGTCTTTGTAAATGCATAAAGG - Intronic
1190709687 X:53058022-53058044 CTATGTTTGTACATGAAAGTGGG + Intronic
1191167292 X:57404331-57404353 CTGTCTTTGTAGATGGATTTTGG + Intronic
1193172184 X:78349139-78349161 CTGTCTTTGTAGATGGATTTTGG + Intergenic
1193619173 X:83729544-83729566 CTGTTTCTGGAAATGTAAGTTGG - Intergenic
1194265567 X:91749511-91749533 GTGTGTTTGCATATGCATGTTGG - Intergenic
1195218185 X:102721172-102721194 CTGTGTTTGTATGTGTGGGTGGG + Intronic
1195241248 X:102954510-102954532 CTGTTTTTGTAATTGTAAATGGG + Intergenic
1195295310 X:103470684-103470706 ATGTGTTTTTAAATGTTTCTTGG + Intergenic
1196110825 X:111945500-111945522 GTGTGTGTGTCTATGTATGTCGG - Intronic
1196644710 X:118105056-118105078 GTGTGTTGGTATATGTGTGTGGG - Intronic
1196711481 X:118768296-118768318 GTGAGATGGTAAATGTATGTTGG - Intronic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1198258987 X:134949749-134949771 GTGTGTCTGTAAAGGTAGGTAGG + Intergenic
1198570120 X:137945846-137945868 CGGTGGTTGTAAATATAGGTAGG - Intergenic
1199195849 X:145029546-145029568 CTGTGTTAATTAATGTATTTTGG - Intergenic
1200582718 Y:4969959-4969981 GTGTGTTTGCATATGCATGTTGG - Intergenic
1201298853 Y:12488992-12489014 ATGTGTTTGTTTATGTATGAGGG - Intergenic
1201393497 Y:13523478-13523500 CTGTGTTGGAAAATGTCTTTTGG - Intergenic