ID: 998544199

View in Genome Browser
Species Human (GRCh38)
Location 5:143012284-143012306
Sequence ACTGAAGGAGTCGCCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998544199_998544203 8 Left 998544199 5:143012284-143012306 CCTTCTTGGGCGACTCCTTCAGT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 998544203 5:143012315-143012337 GAGGCAATAGATGCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998544199 Original CRISPR ACTGAAGGAGTCGCCCAAGA AGG (reversed) Intronic
904738098 1:32650720-32650742 AATGAAGGAATCGCAGAAGATGG - Intronic
905725115 1:40244946-40244968 CCTGCAGGAGTAGACCAAGAAGG - Intergenic
907525496 1:55051564-55051586 ACTGGGGGAGTCGCCCATGCAGG - Intronic
909309720 1:74130524-74130546 AATGAAGGAGCCACTCAAGAGGG - Intronic
915428509 1:155847042-155847064 ACTGAAAGAGTCTTTCAAGATGG - Intronic
918476341 1:184928745-184928767 ACTGAAAGAGGCACCAAAGAGGG - Intronic
918480771 1:184974503-184974525 CCTGGAGGAGGCGCCCCAGAAGG - Exonic
1063631513 10:7738662-7738684 GGTGAAGGATTGGCCCAAGACGG - Exonic
1064169262 10:13015755-13015777 ACAGATGGAGTGGCCCAAGTTGG - Intronic
1069892970 10:71663352-71663374 ACTGAGGGAGAAGCCCAAGGAGG - Intronic
1070464116 10:76702762-76702784 ACTGAAGGAGGCACTGAAGAGGG + Intergenic
1075754745 10:124801840-124801862 ACTGAAGGTGTAGCCCGAAATGG - Exonic
1077081894 11:728060-728082 GCTGACGGAGGCTCCCAAGAAGG + Intergenic
1079581149 11:22066388-22066410 CCTGAAGGGGTTGGCCAAGATGG + Intergenic
1081911280 11:46701356-46701378 AGTGAGGGAGCCACCCAAGAAGG - Intronic
1082958799 11:58899682-58899704 ACTCCAGGAATCACCCAAGATGG + Intronic
1083289616 11:61682535-61682557 CCTGCAGGAGTGGCCCAAGCAGG + Intronic
1084582010 11:70029952-70029974 ACTGGAGGAGTGGGTCAAGAGGG + Intergenic
1084665028 11:70571719-70571741 ACTGGAGGAGTCGGCAAAGGAGG + Intronic
1091667803 12:2431770-2431792 AATGGAGGAGTCCCCCAAGCAGG + Intronic
1092526622 12:9313643-9313665 ACTGAAGGAGTGACTCAGGAAGG - Intergenic
1092540651 12:9418136-9418158 ACTGAAGGAGTGACTCAGGAAGG + Intergenic
1093292389 12:17344148-17344170 ATTGAAGGAGTGTCCCAACATGG - Intergenic
1094512397 12:31104347-31104369 ACTGAAGGAGTGACTCAGGAAGG - Exonic
1096659351 12:53114381-53114403 ATTGAAGGAGGCGGTCAAGAAGG - Intronic
1097056323 12:56252025-56252047 ACTGAAGGAGTCCCGCAGGAAGG - Exonic
1098947596 12:76606034-76606056 ACTGAAGGATTCTCCTGAGAGGG - Intergenic
1109315802 13:60747873-60747895 ACTGAGGGAATCCCCCAAAAGGG - Intergenic
1109785852 13:67173517-67173539 ACTGCAGGAGTTTCACAAGATGG + Intronic
1120325003 14:83013055-83013077 ACAGAAAGAGTAGCCAAAGAGGG - Intergenic
1120442889 14:84561440-84561462 ACTGAAGAAATCTCCCAGGAGGG - Intergenic
1120771001 14:88380293-88380315 ACTGAAAGAGGCACCAAAGAGGG - Intergenic
1127619722 15:60721909-60721931 ACTCAAGGACTCGCCCTAGACGG + Intronic
1129966736 15:79742892-79742914 ACTAGAGGAGTGGCCCAGGATGG - Intergenic
1131159985 15:90099370-90099392 ACTGAAGGAATCGCTGAGGAGGG - Intronic
1132305928 15:100812356-100812378 ACTGGAGAAATAGCCCAAGATGG + Intergenic
1143563793 17:7709610-7709632 ACTGGAGGAGCACCCCAAGAAGG - Exonic
1144046423 17:11458441-11458463 ACAGAAGCAGACGCCGAAGAAGG + Intronic
1145281687 17:21472576-21472598 ACTTCAGAAGTCACCCAAGATGG + Intergenic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147205683 17:38835749-38835771 ACTAGAGGAGTGGCCCAGGATGG + Intronic
1148102615 17:45101820-45101842 ACTGCAGCAGTCTCTCAAGATGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1153032130 18:724463-724485 AGTGAAGTAGTCTTCCAAGAAGG + Exonic
1153306388 18:3635477-3635499 AATGAATGAGTTGGCCAAGAAGG - Intronic
1158580377 18:58675722-58675744 ACTGAAGGATAAGACCAAGAGGG - Intronic
1160298827 18:77660466-77660488 ACTGAAGGAGGCACTGAAGAGGG + Intergenic
1163176411 19:15566782-15566804 ACTGAAGGACTAGACCAAAATGG - Intergenic
1163919903 19:20278662-20278684 CCTGAAGAAGGGGCCCAAGAGGG + Intergenic
1165606969 19:37114079-37114101 CCTGAAGAAGAGGCCCAAGAGGG - Intronic
1166351290 19:42199615-42199637 ACTCAGGTAGTCGCCCCAGAAGG + Exonic
925726997 2:6882950-6882972 AATAAGGGAGTAGCCCAAGAGGG + Intronic
926654556 2:15387095-15387117 TCTGAAGGAGTCGCCCAGGCTGG + Intronic
926775681 2:16420227-16420249 ACTGAAGGAGTTGATCTAGAAGG + Intergenic
932434136 2:71693269-71693291 ACTGGAGGAGCCTCCCAACAAGG - Intergenic
932693873 2:73937293-73937315 AATGGAGGAGTGGCTCAAGATGG - Intronic
934750132 2:96788780-96788802 ACTCAATGAGTCTCCCAGGAAGG - Intronic
940795084 2:158069403-158069425 ACTGCAGGAGCCTGCCAAGAGGG - Intronic
944096565 2:195975184-195975206 ACTGAAAGAGACACCGAAGAGGG + Intronic
946369779 2:219273918-219273940 ACTCAAAGACTCGCCCAAGGTGG + Intronic
947009292 2:225547728-225547750 ACTGAAGGAGGCACTGAAGAGGG - Intronic
1169123482 20:3111074-3111096 CCTGAAGGAGTTGCGGAAGAAGG - Intronic
1169270487 20:4195545-4195567 ACTGAAGGAGAGGCCCAGGAAGG - Intergenic
1169348910 20:4852315-4852337 TCTTAAAGAGTAGCCCAAGAAGG + Intergenic
1171099147 20:22366107-22366129 ACAGAAGGAGACCCCCAATAGGG - Intergenic
1171426513 20:25051942-25051964 AGTCAAGGTGTCCCCCAAGAAGG + Intronic
1174950257 20:55034628-55034650 TCTGAAGTACTCCCCCAAGAAGG - Intergenic
1181045146 22:20210824-20210846 TCTGAAGCAGTTGCCCATGAGGG - Intergenic
1181840034 22:25649174-25649196 AGTGAAGTAGTCTCCCAAGAAGG - Intronic
950261127 3:11544042-11544064 CCTGAAGGAGTGAACCAAGAGGG - Intronic
952684540 3:36132995-36133017 ACTGAAGGAATCTCTCAGGAAGG + Intergenic
953782800 3:45886457-45886479 ACTGGTGGGGTAGCCCAAGAGGG - Intronic
956762096 3:72452602-72452624 ACTGAAAAAGCCACCCAAGAAGG + Intergenic
956922974 3:73950596-73950618 ACTGAGGGAGATGCCCAAAATGG + Intergenic
957443994 3:80291574-80291596 CATTAAGGAGTTGCCCAAGATGG - Intergenic
961296929 3:125892275-125892297 ACTGGAGAAGGAGCCCAAGAGGG + Intergenic
965519473 3:169658685-169658707 GCTGAGGAAGTGGCCCAAGATGG - Intronic
965549731 3:169952222-169952244 AATGACGAAGTCACCCAAGAAGG + Intergenic
968686340 4:1961751-1961773 ATTGAAGGAGCCGCCCTGGAAGG - Intronic
973024168 4:45246170-45246192 ATTGAAGGAATTGCCCAAAAAGG - Intergenic
978767911 4:112423319-112423341 ACTGAAGTAGAGGGCCAAGAAGG + Intronic
980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG + Intergenic
983492986 4:168411300-168411322 ACTGAAGGAGGCACTGAAGAGGG + Intronic
984834677 4:184008974-184008996 AATGTAGGAGTTACCCAAGAAGG + Intronic
986540255 5:8838141-8838163 ACTGATGGAGGAACCCAAGAGGG - Intergenic
986631325 5:9776362-9776384 ACTGAAGGAGGCACTGAAGAGGG - Intergenic
987344319 5:16965239-16965261 ACTGAAGAAGTCATCCAACATGG - Intergenic
992193179 5:74314039-74314061 ACTGAGGGAGTTGCCCGAGATGG + Intergenic
998544199 5:143012284-143012306 ACTGAAGGAGTCGCCCAAGAAGG - Intronic
1001253476 5:170166369-170166391 ACTGAAGCAGTGTCCCAAGCAGG + Intergenic
1004012319 6:11701779-11701801 GTTGAATGAGTCACCCAAGATGG + Intergenic
1009157661 6:60242996-60243018 ACTGAAACAGTCACACAAGAAGG - Intergenic
1010930071 6:81791002-81791024 ACTGTGGGAGTCCCCCAAAATGG - Intergenic
1011823438 6:91279074-91279096 ACTGAATGTGGCTCCCAAGAAGG + Intergenic
1015460580 6:133486967-133486989 ACTGAAGGAGGCACTGAAGAGGG + Intronic
1022309192 7:29179196-29179218 TCTGAAGGGTTCTCCCAAGATGG - Intronic
1026449216 7:70512606-70512628 ACTAAAGGACTCCCCCCAGAAGG + Intronic
1036683705 8:10894433-10894455 ACTGAAGCAGCAGCCCTAGAGGG + Intergenic
1039121506 8:34152884-34152906 ATTGAAACAGTCGCCCAAGCTGG - Intergenic
1040485586 8:47868600-47868622 ATGGAAGGAGTGGACCAAGAAGG + Intronic
1041180981 8:55247770-55247792 ACTGAAAGAGTAGCCCAGTAGGG - Intronic
1042659831 8:71142236-71142258 ACTGGGGGAGTAGCCCAAGATGG + Intergenic
1043157339 8:76800139-76800161 AGTGAAGGAGTCGCACAATTAGG + Intronic
1060945627 9:127568317-127568339 CCTGAAGGACGCGCCCATGAAGG - Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1189070676 X:37860727-37860749 AATGAAGGGCTTGCCCAAGATGG - Intronic