ID: 998545720

View in Genome Browser
Species Human (GRCh38)
Location 5:143025785-143025807
Sequence TTGGCAAAAGACAGGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998545720_998545728 25 Left 998545720 5:143025785-143025807 CCTGGATGCCTGTCTTTTGCCAA 0: 1
1: 0
2: 2
3: 14
4: 172
Right 998545728 5:143025833-143025855 CCCTGACTGTGGCTGAGAGCTGG 0: 1
1: 0
2: 2
3: 26
4: 295
998545720_998545724 14 Left 998545720 5:143025785-143025807 CCTGGATGCCTGTCTTTTGCCAA 0: 1
1: 0
2: 2
3: 14
4: 172
Right 998545724 5:143025822-143025844 TTTAGAACCTCCCCTGACTGTGG No data
998545720_998545730 29 Left 998545720 5:143025785-143025807 CCTGGATGCCTGTCTTTTGCCAA 0: 1
1: 0
2: 2
3: 14
4: 172
Right 998545730 5:143025837-143025859 GACTGTGGCTGAGAGCTGGTAGG 0: 1
1: 0
2: 2
3: 18
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998545720 Original CRISPR TTGGCAAAAGACAGGCATCC AGG (reversed) Intronic
902565266 1:17307228-17307250 CTGGCAAGAGGCAGGTATCCTGG + Intergenic
903673809 1:25052097-25052119 TTGGCAAAGGGCAGCCACCCAGG - Intergenic
904893765 1:33798857-33798879 TAGCCAAAAGACAGGACTCCAGG + Intronic
905862004 1:41358121-41358143 CTGGAAAAAGTCAGCCATCCTGG - Intergenic
906285900 1:44587646-44587668 TGGCCAACAGACAGGCATCAGGG + Intronic
907548385 1:55283311-55283333 TTAGCACAAGACAGGTATCAGGG + Intergenic
908136216 1:61135771-61135793 TTTGCTAACGACAGTCATCCAGG + Intronic
908359005 1:63349311-63349333 TTGGCATAGGATAGACATCCAGG + Intergenic
910429765 1:87148992-87149014 GAGGCAAAAGCCAGTCATCCAGG - Intronic
911642692 1:100305957-100305979 GTGGGAAAAGGCAGGAATCCAGG - Intergenic
916586685 1:166155551-166155573 TTAGCAAAAGACAGGCTCCTTGG + Intronic
917193690 1:172444597-172444619 TTGTCCAAAGACAGGCACCTGGG + Intronic
920212263 1:204336769-204336791 TTGTCAAACTCCAGGCATCCAGG + Intronic
920447475 1:206029694-206029716 GTTGCAAGAGTCAGGCATCCTGG - Intergenic
921505617 1:215965408-215965430 TTGTCAAAACACAGGGATCCCGG - Exonic
921790011 1:219279074-219279096 TTGGGAAAAGACAGTCACACGGG - Intergenic
922033136 1:221823844-221823866 TTGGGAAAAGACAAACATCTTGG - Intergenic
922881918 1:228987567-228987589 ATGGCACAAAACAGGCAGCCTGG - Intergenic
923985230 1:239374461-239374483 TTGGCAAAAGGCACGAATACAGG + Intergenic
924735560 1:246752658-246752680 TGGTCAAAAGACAGGAATCGAGG - Intronic
1064875229 10:19986585-19986607 TGGGTAACAGACAGGCAGCCTGG - Intronic
1065324861 10:24541689-24541711 TTGGGAAAGGCCAGGCCTCCAGG + Intronic
1067192504 10:44083102-44083124 CTGGCACAAGCCAGGCATCATGG - Intergenic
1067440051 10:46303714-46303736 TTGGCAATAGTTAGGCATCAGGG + Intronic
1067576439 10:47411712-47411734 TTGGCAACACTCAGGCATCCGGG + Intergenic
1068112051 10:52691398-52691420 ATGTCAAAAGTCAGGTATCCTGG - Intergenic
1068855443 10:61793249-61793271 TTGGCAGGAGAGAGGGATCCTGG + Intergenic
1070621913 10:78019366-78019388 TAGGAGAAAGAGAGGCATCCTGG + Intronic
1073028288 10:100504720-100504742 TGGGTTAAAGACAGGCATCAAGG + Intronic
1075514962 10:123101242-123101264 GAGGCAAATGACAGGCATCATGG - Intergenic
1075637903 10:124042819-124042841 TTGACACAACACATGCATCCTGG - Intronic
1076107796 10:127837431-127837453 TTGGGAAAATACAGGGATCAAGG + Intergenic
1076313402 10:129523854-129523876 TTGTCAGAAGCCAGGCGTCCTGG + Intronic
1076710847 10:132333035-132333057 TAAACAAAAGACAGGCTTCCTGG + Intronic
1078502546 11:11895727-11895749 CTGGCCAAAGACAGGTATCATGG - Intronic
1079421827 11:20299204-20299226 TTGATAAAAGACTTGCATCCAGG - Intergenic
1080118609 11:28648387-28648409 TTTCCAAAAGACAGTCATACTGG - Intergenic
1080459237 11:32438929-32438951 CTGGCAAAGCGCAGGCATCCCGG + Intergenic
1081274034 11:41124495-41124517 TTAGCCAAAGCCAGGCATACAGG + Intronic
1081845384 11:46237573-46237595 TTTGAAGAAGACAGGCATGCAGG + Intergenic
1085109799 11:73877312-73877334 TTGGAGAAAGACAGGGATACTGG + Intronic
1085882177 11:80480522-80480544 ATGGAAAAAAAAAGGCATCCAGG - Intergenic
1087609601 11:100418045-100418067 TGGGCATAAGACAGGGACCCAGG + Intergenic
1088140847 11:106614239-106614261 TTGAAGAATGACAGGCATCCTGG + Intergenic
1091407226 12:216659-216681 TTTGCAAAAGGTAGGCATCCTGG + Intergenic
1095795344 12:46212768-46212790 ATGCCAACACACAGGCATCCAGG + Intronic
1096050096 12:48599919-48599941 TGGTCAAAAGACAGGAATCAAGG + Intergenic
1098815383 12:75154503-75154525 TTGGCAAATGTCAGGCTTCTAGG + Intronic
1103964129 12:124627326-124627348 TCAGCAAAATACAGGCCTCCCGG + Intergenic
1104881276 12:132072246-132072268 CTGGCAAAAGCCCGGCATCGTGG - Intronic
1105937016 13:25110781-25110803 TCTGCAAAAGAAAGGCAGCCTGG + Intergenic
1106951600 13:34890634-34890656 TTGGAAACAGACACGCATACAGG + Intergenic
1107651137 13:42546404-42546426 TTGGACACAGACAGGCATGCAGG + Intergenic
1115923789 14:38408025-38408047 TAGGCAACACACAAGCATCCAGG + Intergenic
1116272447 14:42788932-42788954 TTGGCAAAAGGCAGGCACATGGG + Intergenic
1116764650 14:49055009-49055031 TTGGCAAAACACAGCGATACTGG + Intergenic
1118326010 14:64781424-64781446 TTCGCAAAAGACACACATGCAGG + Intronic
1119111011 14:71973866-71973888 TTGGCAGGAGACAGGCATGCAGG + Intronic
1121961376 14:98263287-98263309 TTGGCAAAAGTCAAGAACCCAGG + Intergenic
1123870923 15:24571798-24571820 TTGGCAACATATAGGCCTCCTGG + Intergenic
1124404838 15:29383531-29383553 TGGGCACAAGCCAGGCATCCGGG + Intronic
1124702533 15:31929139-31929161 TTGGCACAAGAAAGGCATTTGGG - Intergenic
1125435581 15:39641417-39641439 GAGGCAAATGACAGGCATCCAGG - Intronic
1130540615 15:84818355-84818377 AAGACAATAGACAGGCATCCAGG + Intronic
1130733661 15:86525676-86525698 TTGGTGAGAGACAGGGATCCAGG - Intronic
1131116145 15:89797197-89797219 CTGGCAAAAGACAGGTCTTCTGG + Intronic
1131381845 15:91970680-91970702 TGACCAAAAAACAGGCATCCAGG + Intronic
1132675471 16:1119562-1119584 TTGGCAAGGGACAGGCGTCTTGG + Intergenic
1136500375 16:30667189-30667211 GAGGCAGAAGATAGGCATCCAGG + Intronic
1137741653 16:50782404-50782426 TGGGAAGAAGAAAGGCATCCAGG + Exonic
1139008890 16:62608014-62608036 TTGCCAAATGACAGGCTTACAGG + Intergenic
1141426646 16:83948647-83948669 TTGACAAAATACAGGCTGCCAGG + Intronic
1142669494 17:1481257-1481279 TTGGAGAAACACAGGCTTCCAGG - Intronic
1146372767 17:32275650-32275672 TTAGGGAGAGACAGGCATCCTGG - Intronic
1146925317 17:36740350-36740372 TTGGCAGAAGACAGGCATGAGGG - Intergenic
1149829649 17:59860938-59860960 CTGGCAAAGGAGAGGCACCCGGG + Intronic
1150038558 17:61832165-61832187 TTGGCAAAAGATAGTGTTCCAGG - Intronic
1152064339 17:78102212-78102234 ATGGGAAAACACAGGCCTCCCGG + Intronic
1155094428 18:22542410-22542432 TTGGAGACAGACAGGCATGCAGG + Intergenic
1155258305 18:24017306-24017328 ATGGCAAAAGACTGGAACCCAGG - Intronic
1156141611 18:34119141-34119163 TAGACAAAAGACAGACATACTGG + Intronic
1160279491 18:77474333-77474355 TTGGTAAAACCCAGGAATCCTGG - Intergenic
1164412076 19:28014464-28014486 GGGGCAAAGGACAGGCATTCGGG + Intergenic
1165369669 19:35396899-35396921 TTGGCTAAACGCAGGCATCAGGG - Intergenic
1167236847 19:48320628-48320650 TTGGCAGGGGACAGGCCTCCTGG + Intronic
1167307273 19:48716436-48716458 TTTGGAGAAGACAGGCATCCTGG - Intronic
1168516205 19:57012116-57012138 ATGGGAACAGACAGGCATGCAGG - Intergenic
927005319 2:18842667-18842689 TTGGCATAACACAGGCTTTCTGG - Intergenic
928483874 2:31710195-31710217 TAGGAAGAAGACAGGAATCCAGG + Intergenic
931911063 2:66900941-66900963 TCGCCAATAGACAGGCATCAAGG - Intergenic
932010132 2:67968177-67968199 TTGGAAAAGGAAAGGAATCCTGG - Intergenic
935587337 2:104813366-104813388 TTGCCTAAATACAGGCATACAGG - Intergenic
937079361 2:119129299-119129321 GTGTGAAAAGACATGCATCCTGG - Intergenic
937298738 2:120825680-120825702 CAGGCAAAGGACAGGCATCTGGG - Intronic
938406141 2:131034415-131034437 TTTGGAAAAGCCAGGCGTCCAGG - Intronic
938698868 2:133858771-133858793 TTGGCAATAAACTGGCATACAGG - Intergenic
942233642 2:173883146-173883168 TTGGTAGAAGACAGGTAGCCAGG - Intergenic
943699315 2:190972533-190972555 TTGGCAGAAGACAGCCAGCTTGG + Intronic
945807848 2:214512215-214512237 TTGGCAAATGAAAGACATGCTGG - Intronic
1170991728 20:21307747-21307769 TTGGCAAAAGACAGGTGGCAGGG - Intronic
1174549204 20:51349576-51349598 TTGCCAAATGAAAGTCATCCAGG - Intergenic
1174772336 20:53312355-53312377 TCGTCAAAAGACAGACATGCTGG - Intronic
1175427872 20:58881377-58881399 TTGGCAGAAGACAGGGATCCAGG + Intronic
1175486877 20:59353281-59353303 TTGGGAGAAGTCAGGAATCCTGG - Intergenic
1175575057 20:60054796-60054818 TTGGCAGCAGACAGACATCCAGG - Intergenic
1175710614 20:61217523-61217545 TTGACAGAAGACAGGCTTCTGGG + Intergenic
1179000661 21:37455075-37455097 CTGGCAAAAAACAGGCTCCCAGG + Intronic
1180501832 22:15936737-15936759 TTGGCAAAAGACAGTGACCTTGG + Intergenic
1181593287 22:23897374-23897396 TTTGCAACAGACAGACAGCCTGG + Intronic
1182470736 22:30546724-30546746 CTGGCAAAAGGCAGGCCACCTGG - Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949731813 3:7122568-7122590 TTTGCAAAAGAAAGTCAACCTGG - Intronic
953807649 3:46085338-46085360 TTGGCCAAAGTCATGCAGCCAGG + Intergenic
955223815 3:57044823-57044845 TGGCCTAAAGACAGGCATCCTGG - Intronic
955963417 3:64363900-64363922 TAGGGAAAAGAAAGACATCCTGG - Intronic
955974302 3:64465745-64465767 CTGGCAAAAGGCAGGCATGCAGG + Intergenic
959086630 3:101857154-101857176 TTCACAAAAGACAGGCAACTGGG - Exonic
959560492 3:107774257-107774279 TTGGCAAAAGGTAGTCCTCCAGG - Intronic
961783707 3:129336779-129336801 GTTGCACAAGACAGACATCCAGG - Intergenic
964145367 3:153454986-153455008 TTGGCGAAAGGCAGGAAACCCGG + Intergenic
968992946 4:3926979-3927001 TGGGAATAAGACAGGCAGCCAGG + Intergenic
969641798 4:8403276-8403298 CTTGGAAAAGACAGACATCCAGG + Intronic
969822529 4:9731382-9731404 TGGGAATAAGACAGGCAGCCAGG - Intergenic
973918454 4:55660542-55660564 TTGACAAAAAACAAGCATACAGG - Intergenic
977092204 4:92691706-92691728 TTGGAAAACGGCAGTCATCCTGG + Intronic
977664990 4:99635928-99635950 TTGCACAAAGACAGACATCCAGG - Intergenic
978029114 4:103916485-103916507 TTGGCAAAAGACATGAATCCTGG - Intergenic
982167392 4:152627004-152627026 TTGACAAAAGACAGACTTCATGG - Exonic
983992279 4:174134851-174134873 ATGGCAGAAGACAGGAAGCCTGG + Intergenic
987607841 5:20161234-20161256 TTGGCATCAGCCAGGCATCTAGG - Intronic
988393885 5:30671869-30671891 TTGAGAAAAAACAGTCATCCAGG - Intergenic
988817315 5:34847217-34847239 CTTGCAAAGGACAGTCATCCTGG + Intronic
991023043 5:62000740-62000762 TTATCAAGAGACAGGCTTCCTGG - Intergenic
994272851 5:97802444-97802466 TTGGGAAAGGACAGGCAAACAGG + Intergenic
998545720 5:143025785-143025807 TTGGCAAAAGACAGGCATCCAGG - Intronic
999380692 5:151119121-151119143 TGGGGAAAAGACAGGTGTCCTGG - Intronic
1002091936 5:176811001-176811023 TTGGCAGAACCCAGGCTTCCGGG - Intronic
1005805678 6:29472269-29472291 CTGACTAAAGACAGGCAGCCCGG + Intergenic
1007666351 6:43515669-43515691 CTGGGAAAAGACAAGCCTCCAGG - Exonic
1007843504 6:44735700-44735722 TTGGGAAAACACAGGCATGGAGG + Intergenic
1008150216 6:47941056-47941078 TTGCCAACAGTCAGGCATGCTGG - Intronic
1009906827 6:69879645-69879667 TAGGGACAAGACAGGTATCCAGG + Exonic
1011237524 6:85233720-85233742 GTGGCAGAAGAGAGGCATGCAGG - Intergenic
1011371086 6:86637221-86637243 TGGGGAGAAGACAGGCATACAGG + Intergenic
1013086967 6:106865106-106865128 TATGCAAAAGCAAGGCATCCAGG + Intergenic
1014961424 6:127690831-127690853 GTGGCAAAAGAAAGGTAGCCAGG + Intergenic
1018547230 6:164951062-164951084 TTGGCAAAAGACAGAGTCCCTGG - Intergenic
1018796114 6:167186831-167186853 TTGGAAGAGGACAGTCATCCGGG - Intronic
1018820207 6:167368226-167368248 TTGGAAGAGGACAGTCATCCGGG + Intronic
1019201573 6:170320701-170320723 CTGGCAAGAGACAGACATCTGGG + Intronic
1021181079 7:17506793-17506815 TTGGCTAAAGGCAGGCATCTGGG + Intergenic
1023685511 7:42730478-42730500 TTGGCAATACACAGGCAGCAAGG - Intergenic
1024024042 7:45396356-45396378 TGGGAAGAAGACAGTCATCCAGG - Intergenic
1030267910 7:107639548-107639570 TTGGTGAAAGCCAGGAATCCTGG - Intergenic
1031976759 7:128098818-128098840 TTGGGAAAAAGCAGCCATCCAGG + Intergenic
1032782736 7:135177216-135177238 TGGGCAGAAGACAGTCCTCCAGG + Intergenic
1034046120 7:147929651-147929673 TTGGCAAAATACAGGCATTTTGG - Intronic
1034311218 7:150090495-150090517 TTGACTAAAGACAAGAATCCGGG + Intergenic
1034795637 7:154010148-154010170 TTGACTAAAGACAAGAATCCGGG - Intronic
1034982601 7:155488520-155488542 TTTGCCCAAGACAGACATCCTGG + Intronic
1036769351 8:11567952-11567974 TTAGCATAAGACAGGCACTCTGG - Intergenic
1037688940 8:21166712-21166734 TTGGCAGAAGGCAGGAATCAAGG - Intergenic
1038258435 8:25972051-25972073 CTGACAAGAGACAAGCATCCTGG + Intronic
1039212390 8:35232667-35232689 TTGGCCAGAGACAGTGATCCTGG + Intergenic
1039261984 8:35781812-35781834 TTGGCAACAGACAGTCCTCAAGG + Intronic
1046173389 8:110543074-110543096 TAGTCCAAAGACTGGCATCCTGG - Intergenic
1047356064 8:124123407-124123429 CTGGCATCAGAGAGGCATCCTGG + Intergenic
1048071424 8:131025817-131025839 TTGAGAAAAGTGAGGCATCCAGG - Intronic
1051196109 9:14564434-14564456 TTTGCAAGAGGCAGGCCTCCTGG - Intergenic
1052167483 9:25350963-25350985 TGGGCTGAAGAGAGGCATCCAGG + Intergenic
1053350593 9:37411147-37411169 CAGGCAGAAGCCAGGCATCCTGG - Intergenic
1055551302 9:77434417-77434439 CTGGCAAGATCCAGGCATCCAGG - Exonic
1055757827 9:79573402-79573424 CCGGCCAAAGACAGGCACCCAGG - Intronic
1056802614 9:89703417-89703439 TTGGCCAAAGGCAAGCTTCCTGG - Intergenic
1058058980 9:100474927-100474949 TGGGGCAAAGACAGGCATTCAGG + Intronic
1058642059 9:107097143-107097165 GTCACAAAAGACAGACATCCTGG + Intergenic
1059724886 9:116997573-116997595 TTGAGAAAAGAGAGGCATTCTGG - Intronic
1060656725 9:125377072-125377094 TTCACAAAAGAAAGGCAGCCCGG + Intergenic
1060723760 9:125994526-125994548 GTGGCCAAATGCAGGCATCCAGG - Intergenic
1061571784 9:131482258-131482280 TTGGCAAGGGACAGGCAGCTGGG + Intronic
1188884640 X:35534338-35534360 TTTCCAAAGGGCAGGCATCCAGG + Intergenic
1189893859 X:45633221-45633243 TTGGCAACATGCAGGCATGCAGG - Intergenic
1190365618 X:49691532-49691554 TTGGCAGAAGACAGGAAAACAGG + Intronic
1195657047 X:107341772-107341794 TTGGCAAAATACAGGGCTCTGGG - Intergenic
1196190999 X:112794312-112794334 TTGGCTAAAGATAGGCATGCAGG + Intronic
1197632415 X:128876631-128876653 TAGGCAACACACTGGCATCCAGG - Intergenic
1198232674 X:134707035-134707057 TTGGCAAAAGACAAACCTACAGG + Intronic
1198308722 X:135408033-135408055 CTGACAAAAGACAGGCAAACAGG - Intergenic
1199310275 X:146313303-146313325 TTGGCAAAAGAATTGCATGCAGG + Intergenic