ID: 998549439

View in Genome Browser
Species Human (GRCh38)
Location 5:143063280-143063302
Sequence GGAAAGACACAATGGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998549439_998549441 -6 Left 998549439 5:143063280-143063302 CCAAGCTGCCATTGTGTCTTTCC 0: 1
1: 0
2: 2
3: 33
4: 284
Right 998549441 5:143063297-143063319 CTTTCCCACGCTGCTTGCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 54
998549439_998549448 21 Left 998549439 5:143063280-143063302 CCAAGCTGCCATTGTGTCTTTCC 0: 1
1: 0
2: 2
3: 33
4: 284
Right 998549448 5:143063324-143063346 CTCCCTATTGCTCTGGCTGGTGG 0: 1
1: 0
2: 1
3: 35
4: 419
998549439_998549451 29 Left 998549439 5:143063280-143063302 CCAAGCTGCCATTGTGTCTTTCC 0: 1
1: 0
2: 2
3: 33
4: 284
Right 998549451 5:143063332-143063354 TGCTCTGGCTGGTGGAGCTCTGG No data
998549439_998549444 14 Left 998549439 5:143063280-143063302 CCAAGCTGCCATTGTGTCTTTCC 0: 1
1: 0
2: 2
3: 33
4: 284
Right 998549444 5:143063317-143063339 AGGCCTCCTCCCTATTGCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 191
998549439_998549446 18 Left 998549439 5:143063280-143063302 CCAAGCTGCCATTGTGTCTTTCC 0: 1
1: 0
2: 2
3: 33
4: 284
Right 998549446 5:143063321-143063343 CTCCTCCCTATTGCTCTGGCTGG 0: 1
1: 0
2: 3
3: 15
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998549439 Original CRISPR GGAAAGACACAATGGCAGCT TGG (reversed) Intronic
901571682 1:10165995-10166017 GGAAAGACACAAGAACAGCCAGG - Intronic
902301353 1:15504924-15504946 GGAAAGACACCTTGACAGCAAGG + Intronic
902478927 1:16701629-16701651 GGAAAGCCACTGTGGGAGCTTGG + Intergenic
904082561 1:27881524-27881546 GGAAAGAAAAGATGGCAGCGGGG + Intronic
904915037 1:33963981-33964003 GGACAAACACCTTGGCAGCTTGG - Intronic
906788827 1:48640968-48640990 GGATAGAGAAAAAGGCAGCTTGG + Intronic
907564572 1:55422815-55422837 GGGAAGATGCTATGGCAGCTTGG + Intergenic
907928299 1:58975193-58975215 GGGAAAACACAATGGCAGATTGG - Intergenic
909354501 1:74692891-74692913 GGAAATACACAATCTAAGCTGGG - Intergenic
911225400 1:95299377-95299399 GGAAAGACAGAATTGCAGAGAGG - Intergenic
911349252 1:96732882-96732904 GAAAAGATAGAATGGCAGATAGG + Intronic
911664235 1:100535900-100535922 GGCAACACAAAGTGGCAGCTGGG + Intergenic
912258730 1:108087359-108087381 GGACAGACAGAATTGCAGCAGGG + Intergenic
912472993 1:109918486-109918508 GGCTAGACACATTGGCGGCTTGG + Intronic
913083109 1:115408420-115408442 GGAAAGACAAAATGGTAGGCTGG + Intergenic
915234910 1:154473505-154473527 GAAAAAAAAGAATGGCAGCTGGG + Intronic
915488456 1:156238437-156238459 TGAATGACACAGTAGCAGCTTGG + Intronic
916167229 1:161974956-161974978 GGAGAGACACAAAGGCAACGTGG + Intergenic
918782422 1:188718314-188718336 GGAAAGAAATAATGGCAACCTGG - Intergenic
919475957 1:198034270-198034292 GGCAAGAGATGATGGCAGCTGGG + Intergenic
921788285 1:219259467-219259489 GGAAAGAGATAATGGCATTTAGG + Intergenic
923324492 1:232869306-232869328 GGAAAGAAACCATGGCTTCTTGG - Intergenic
923414057 1:233737570-233737592 GGAAAGACAAAAGAGCAACTGGG - Intergenic
1063293919 10:4782251-4782273 GGTAAGACACACTAGCAGCTCGG - Intergenic
1063384707 10:5608823-5608845 GGGAAGACGAATTGGCAGCTGGG + Intergenic
1063627288 10:7702006-7702028 ATTAAGACCCAATGGCAGCTGGG - Intergenic
1065037292 10:21652781-21652803 GGAAAGTCAGAATGGAAGCAGGG + Intronic
1065162612 10:22938528-22938550 GTTAAGATACAATGGCAGCTTGG + Intronic
1066377651 10:34872152-34872174 AGAAAAACAGAATGGCGGCTGGG - Intergenic
1066508440 10:36068280-36068302 GGAAAGATATAATGACAGCTGGG - Intergenic
1067023863 10:42826883-42826905 GGCAGGGCGCAATGGCAGCTGGG + Intronic
1067918178 10:50423168-50423190 GGAAAGCCACAGGGGCAGCTGGG + Intronic
1068548191 10:58376442-58376464 GGAAAGAGACAATGGAATCCAGG - Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1073249809 10:102114616-102114638 GGAAAGTTACAATGGCCACTGGG + Intronic
1073308659 10:102523664-102523686 GGAATGAGAAATTGGCAGCTTGG - Intronic
1073568484 10:104556049-104556071 ACAAAGACCCAATGGCAGCAGGG - Intergenic
1074312337 10:112332950-112332972 GGAAAAACGCTATGGCAGGTGGG - Intergenic
1075650617 10:124126383-124126405 GGCAAGACACAATGGGTGCTGGG - Intergenic
1075672296 10:124270862-124270884 GGGAAGAGCCAATGGCACCTGGG - Intergenic
1076154076 10:128189300-128189322 GGCAAGAGACAATGCCGGCTTGG + Intergenic
1077734781 11:4778479-4778501 GGAAAGACACATAGGCAAATGGG - Intronic
1078148086 11:8735794-8735816 GGAGGGACACAATGGGAGCCAGG + Intronic
1078462887 11:11528691-11528713 AGAAAGACATGATGGGAGCTAGG + Intronic
1079390655 11:20019203-20019225 GGAAAGAGATGATGGCATCTTGG + Intronic
1080738431 11:35040436-35040458 GGAAAGACAGATTGGCATATGGG + Intergenic
1080846647 11:36032751-36032773 GGCAAGAGATAATGGCGGCTTGG + Intronic
1080935002 11:36853668-36853690 GCAAAGAAACAATGTCATCTAGG - Intergenic
1081804240 11:45881688-45881710 GGGAAGGAACAATGACAGCTGGG - Exonic
1082058419 11:47839485-47839507 GGCAAGACACAGTGGCAACTTGG + Intronic
1082711599 11:56559775-56559797 GGAGAAACACAATAGCATCTAGG + Intergenic
1082935150 11:58648173-58648195 GGAAAAAAAAAATGGCAGATAGG - Intronic
1083278593 11:61611466-61611488 GCACACACACAAGGGCAGCTTGG + Intergenic
1083466117 11:62847409-62847431 GGAAAGAAACACTGGTGGCTGGG + Intergenic
1085709007 11:78812364-78812386 AGAAAGAGACAAAGGCAGTTGGG - Intronic
1086147212 11:83565386-83565408 GGAAAGAGAAAAAGGCAGCCAGG + Intronic
1087360796 11:97156987-97157009 AGAAATACACAATAGCAACTTGG - Intergenic
1087494984 11:98880012-98880034 ATAAAGACACGATGGCTGCTGGG - Intergenic
1087790216 11:102398520-102398542 TGAAAGACAGAATGCCATCTGGG - Exonic
1089131040 11:116212185-116212207 GGAAAGACCTAATTGCAGATGGG - Intergenic
1089362983 11:117903475-117903497 GGAAAGAAACACAGACAGCTGGG + Intronic
1089523541 11:119081665-119081687 GAACAGACACAATGGGACCTGGG + Exonic
1090643715 11:128750327-128750349 GGAAGGACACAATGGGACATTGG + Intronic
1091340617 11:134809922-134809944 GTAAAGAAATAATGGCAGCCAGG - Intergenic
1092711499 12:11342318-11342340 GGAAGGTTACAAGGGCAGCTAGG - Intergenic
1092754675 12:11752395-11752417 GGAGAGAGACAATGAAAGCTTGG - Intronic
1094024355 12:25946788-25946810 GGAAAGCCTAAATGGCTGCTTGG - Intergenic
1097659832 12:62417229-62417251 GGAATGGCACAGTGGCATCTTGG + Intronic
1098021699 12:66162755-66162777 GGAATAACAAAATTGCAGCTTGG - Intronic
1098732972 12:74062479-74062501 GGAAAGAGACAAAGGTAGGTGGG - Intergenic
1098787905 12:74782447-74782469 GGAAAGAAAGACTGGCAGCCTGG - Intergenic
1101058546 12:100946415-100946437 GGAAAGAGATGATGGTAGCTTGG + Intronic
1101334703 12:103786171-103786193 TAAAATACACAATGGCAGGTGGG + Intronic
1101569804 12:105943259-105943281 GGAATGACACAATGGAATTTGGG - Intergenic
1102538194 12:113597817-113597839 TGAAAGACAAAATGTGAGCTAGG + Intergenic
1102732411 12:115124248-115124270 GGCAAGAAATAATGGTAGCTTGG - Intergenic
1104051375 12:125196093-125196115 GGCAAGTGACAATGGCTGCTTGG + Intronic
1104605260 12:130183464-130183486 AGAAGGACACTATGGCATCTTGG + Intergenic
1105378888 13:19868153-19868175 GGAGAGAAAGAATTGCAGCTGGG - Intergenic
1108248497 13:48541590-48541612 GGAAGGACACAATACCATCTAGG - Intergenic
1108623666 13:52207459-52207481 GGACAGACAGAATGGCTGCATGG - Intergenic
1108663049 13:52603572-52603594 GGACAGACAGAATGGCTGCATGG + Intergenic
1109306562 13:60648069-60648091 GTACAGACACAATGTCAGCTTGG + Intergenic
1109328117 13:60894854-60894876 GGAAAAACACAATGAAAGCCAGG + Intergenic
1110290037 13:73794700-73794722 AGAATGACACACTGACAGCTGGG - Intronic
1111373609 13:87350480-87350502 GGAAAGATACATTGGCAGTGGGG - Intergenic
1112967203 13:105211548-105211570 GGCAAGACACAGAGCCAGCTGGG - Intergenic
1113728320 13:112622367-112622389 GGAAGGACACAGGGACAGCTAGG - Intergenic
1114352841 14:21872782-21872804 GGAAAGACACTATAGAAGCCAGG - Intergenic
1115088721 14:29548315-29548337 GGAAAGAAACAGTGGAAGGTAGG + Intergenic
1116981080 14:51171209-51171231 GGAAATACACAATATCACCTAGG - Intergenic
1117445630 14:55801346-55801368 GGGAATAAACAAAGGCAGCTTGG - Intergenic
1118140488 14:63075348-63075370 GGAAAGAAAGAATGTCAGCTGGG + Intronic
1119740609 14:77011687-77011709 GGAAGGAGAGAATGGCAGCCAGG - Intergenic
1120221395 14:81737959-81737981 GGAAAGACACATTGGCATGCTGG - Intergenic
1121368491 14:93336134-93336156 GGAAATACAGGATGGAAGCTGGG + Intronic
1121463369 14:94098951-94098973 GGAAAGGCAGAATGGCACCGTGG - Intronic
1121796167 14:96737192-96737214 TGGAAGACACACTGGCAGTTAGG - Intergenic
1121938778 14:98046793-98046815 GGAACAACACAATGGCTGGTTGG - Intergenic
1123159107 14:106260329-106260351 GGGAAGACATAGTGGCTGCTGGG + Intergenic
1123160226 14:106271167-106271189 GGGAAGACATAGTGGCTGCTGGG + Intergenic
1123425011 15:20163920-20163942 GGCAGGGCACAATGGCAGCTGGG + Intergenic
1123534235 15:21170453-21170475 GGCAGGGCACAATGGCAGCTGGG + Intergenic
1124137704 15:27049244-27049266 GCAAAGACACATCAGCAGCTGGG - Intronic
1125577530 15:40765798-40765820 GGTAAGCCACAGTGGCTGCTTGG - Exonic
1127281784 15:57499135-57499157 GGAAGGAAACGTTGGCAGCTTGG + Intronic
1128594851 15:68934964-68934986 GGAAAGACACAAAGTGGGCTTGG - Intronic
1129490809 15:75923815-75923837 GGAAAGAGGAGATGGCAGCTTGG + Intronic
1130034519 15:80344932-80344954 GGAAGGATACAATAGCAGTTGGG + Intronic
1130047744 15:80459313-80459335 GTGCAGACAGAATGGCAGCTTGG + Intronic
1132064405 15:98718637-98718659 GGAAATCCAGAATGGCAGCCTGG - Intronic
1133395955 16:5447689-5447711 AGAAAGAGAGAATGGCAGCCGGG - Intergenic
1133877011 16:9744538-9744560 GGAAAGACAGAGTGGGACCTGGG + Intergenic
1135132140 16:19861914-19861936 AAAAAGACCCAGTGGCAGCTTGG - Exonic
1135464613 16:22674687-22674709 GAAAAGCCACACTGGCAGCTGGG + Intergenic
1136107424 16:28040135-28040157 TGAAGGAGACGATGGCAGCTAGG - Intronic
1136859846 16:33691825-33691847 GGCAGGGCACAATGGCAGCTGGG - Intergenic
1140340581 16:74155769-74155791 GGCAAGAGATAATGGCAGATTGG - Intergenic
1141326721 16:83067121-83067143 GCAAAGACAAAATGGCTCCTAGG - Intronic
1142351977 16:89584747-89584769 GGAGAGGCACAAGGGCTGCTGGG - Intronic
1203121351 16_KI270728v1_random:1540004-1540026 GGCAGGGCACAATGGCAGCTGGG - Intergenic
1144739757 17:17575280-17575302 GGACACACACAATGGCACTTAGG + Intronic
1146645361 17:34573659-34573681 GGAAAAACACAAAGGAAGCTGGG + Intergenic
1147855680 17:43477977-43477999 TGAAAGACACAACTGCAGGTTGG + Intergenic
1150240016 17:63623150-63623172 GAAAAGACACAACAGCAGCTGGG - Intronic
1150964082 17:69947606-69947628 GGGAAGAAAGAATAGCAGCTTGG + Intergenic
1151502493 17:74500327-74500349 GGAGTCACACAATGGCACCTTGG + Intergenic
1155527736 18:26734503-26734525 CCAAAGACACCATGGCAGTTTGG - Intergenic
1155757806 18:29523599-29523621 GGCAAGACATACTGGTAGCTTGG - Intergenic
1156489932 18:37490110-37490132 GGAAAGCCACATTGTCAGATGGG + Intronic
1158349154 18:56547255-56547277 GGTAAGACAAGATTGCAGCTGGG - Intergenic
1158751518 18:60266407-60266429 GAAGAGACAGAATGGCTGCTTGG + Intergenic
1159419275 18:68195620-68195642 ACAAAGACACAATGGCAGGCAGG + Intergenic
1159736997 18:72112662-72112684 TGTAAGAGACAAGGGCAGCTGGG - Intergenic
1159894075 18:73980218-73980240 GGAAAGACGTGATGGCAGCTTGG - Intergenic
1160310347 18:77784126-77784148 GGAAAGACAAACTGGAAGGTGGG - Intergenic
1160491901 18:79345093-79345115 AGAAAGTCACTAAGGCAGCTTGG + Intronic
1161650332 19:5480407-5480429 GCAAAGACACAAAGGAGGCTAGG + Intergenic
1162272921 19:9630916-9630938 GAAAAGACACAATGGGTACTCGG + Intronic
1165503272 19:36207076-36207098 GGAAGGAGACAAGGGCAGCTGGG + Intronic
1165704949 19:37969003-37969025 GAACAGAGACAATGGCTGCTAGG + Intronic
1168024902 19:53636932-53636954 GGAGAGCCAGAATGGAAGCTTGG - Exonic
1202712968 1_KI270714v1_random:27536-27558 GGAAAGCCACTGTGGGAGCTTGG + Intergenic
926604637 2:14885215-14885237 GGGAAGAGATAATGGTAGCTCGG + Intergenic
927354116 2:22153329-22153351 GGCAAGACACATAGACAGCTTGG + Intergenic
928456019 2:31422970-31422992 GAAAAGACAGAATGGGAGCCTGG - Intergenic
929364180 2:41131974-41131996 GGAGAGAGAAAAAGGCAGCTGGG + Intergenic
929456770 2:42071774-42071796 GGAAACACACAAGGAGAGCTGGG + Intergenic
930154629 2:48093434-48093456 AGAAACACACACTGCCAGCTGGG - Intergenic
933727823 2:85436525-85436547 GGACAGACACAGCGGCAGCCGGG + Exonic
934458206 2:94192933-94192955 GGCAGGGCGCAATGGCAGCTGGG - Intergenic
934864905 2:97799230-97799252 TGAAAAACACAATGGCTGCTAGG - Intronic
935388591 2:102526317-102526339 GAAGAGACACAAGGGCTGCTGGG + Exonic
936175414 2:110215699-110215721 GAAAAGAGGCGATGGCAGCTTGG - Intergenic
936175460 2:110216223-110216245 GGAAAGAAAGAATTGCAACTTGG - Intergenic
937256216 2:120557701-120557723 GGCAAGAGACAATGGTGGCTTGG - Intergenic
937278201 2:120699804-120699826 GCAAAGACATAAAGGCAGTTGGG + Intergenic
939145793 2:138413107-138413129 GGAAGAACACCATGGCAGCATGG - Intergenic
940620645 2:156109011-156109033 GGAAAGACTCAAAGGCAGATAGG + Intergenic
941959079 2:171235931-171235953 CTAAAGAATCAATGGCAGCTGGG + Intergenic
942994588 2:182245953-182245975 GGCAAGAGATGATGGCAGCTTGG - Intronic
946215620 2:218181264-218181286 AGAAATAAACAATGACAGCTTGG + Intergenic
946359568 2:219210940-219210962 GGAAAGCCATAATGGCATCATGG + Exonic
946973124 2:225117920-225117942 AGAAAGACTCAATGGCACATAGG + Intergenic
947325325 2:228968104-228968126 GTAAAGACACTATGGGAGATTGG - Intronic
947688546 2:232113216-232113238 GGAAAAACTCAAGGACAGCTAGG - Intronic
947819346 2:233059627-233059649 GGAGACACACAAAGGGAGCTTGG - Intergenic
948446094 2:238034101-238034123 GGAAAGAAACACTGGCTCCTTGG + Intronic
1168900129 20:1356771-1356793 GGATGGACACAATGGCAGAGTGG - Intronic
1169024519 20:2357683-2357705 GGGAAGACAAAAAGACAGCTTGG + Intergenic
1169404534 20:5312401-5312423 GGAAAGACACAAAGTCAGCCCGG - Intronic
1169568812 20:6884924-6884946 GAAGAGAAAGAATGGCAGCTAGG + Intergenic
1169810919 20:9608269-9608291 GGAATGACAGAATGTCAGGTTGG + Intronic
1170036776 20:11997995-11998017 GGAATAACAAAATGGAAGCTGGG + Intergenic
1170566656 20:17611630-17611652 GGAAAGAGACAAGGGATGCTGGG - Intergenic
1171566611 20:26198345-26198367 TGTAAGACACAATGTCAGCAAGG - Intergenic
1174461276 20:50684673-50684695 AGAGAGACACCATGGCCGCTGGG + Intronic
1175298070 20:57923029-57923051 GGAAACCCACAAAGGCACCTTGG + Intergenic
1175428160 20:58883581-58883603 AGAAAGACACAGTGCCATCTGGG + Intronic
1175770902 20:61623578-61623600 GGAAAGACAACACGGCCGCTGGG - Intronic
1180676075 22:17587372-17587394 GGAAGGACACAGAGGCAGATAGG - Intronic
1181358003 22:22313494-22313516 GGCAGGGCGCAATGGCAGCTGGG + Intergenic
1181939078 22:26461562-26461584 CAAATGACACAAGGGCAGCTTGG + Intronic
1182516210 22:30860549-30860571 GGACAGACCCCATGCCAGCTGGG - Intronic
1182839541 22:33376955-33376977 GGAGAGAATGAATGGCAGCTAGG - Intronic
1182861724 22:33565951-33565973 GGAAACTCCCCATGGCAGCTAGG - Intronic
1183268162 22:36843638-36843660 GGAAAGACCAACTGGAAGCTAGG + Intergenic
1183837987 22:40472745-40472767 GCCAAGACACCATGGAAGCTGGG - Intronic
1184066957 22:42126623-42126645 GCAAAGACACCATGGTGGCTGGG + Exonic
949497976 3:4651471-4651493 GGAAACAAACAAGGCCAGCTTGG - Intronic
949736512 3:7178641-7178663 GGAAAGGCAAAATTGCAGATGGG + Intronic
949776593 3:7639387-7639409 GGAGAGATAGAAGGGCAGCTTGG - Intronic
950250621 3:11462400-11462422 GGAAAGACACCAGGGCAGTCAGG + Intronic
950735646 3:15005832-15005854 GAAAAGACAGATTGTCAGCTGGG - Intronic
952863433 3:37833866-37833888 GCAAAGACCTAATGGCAGATGGG + Intergenic
953247604 3:41209407-41209429 GGAAAGACAGAATTGCATTTCGG - Intronic
953833657 3:46324770-46324792 GGAAGAAGACAATGGCAGGTAGG + Intergenic
955258921 3:57364471-57364493 GGAAAAACACTATGGTACCTGGG - Intronic
956612281 3:71135979-71136001 GGAAAGGCAGAACGGGAGCTTGG - Intronic
957111532 3:75966210-75966232 TGTAAGACACAATGTCAGCAAGG + Intronic
958762531 3:98326576-98326598 GGAAAGGCATAATGGGAGGTGGG - Intergenic
961145398 3:124588878-124588900 GTGAAGACACAATGGCACGTGGG - Intronic
961444455 3:126972643-126972665 GGAATGCCACCATGGCAGCTGGG - Intergenic
961978660 3:131053998-131054020 CCTAAGACACACTGGCAGCTTGG - Intronic
962837764 3:139204022-139204044 TGAGAGACAGAATGGCAGGTAGG + Intronic
963980915 3:151536062-151536084 GACAGGACACAGTGGCAGCTAGG - Intergenic
964149173 3:153503391-153503413 GGCAAGAGACAATGGTGGCTGGG + Intergenic
965058327 3:163749915-163749937 GGAAAGCAAAAATGGCAGCCCGG - Intergenic
965480129 3:169208474-169208496 GGAAAGACACAGTGGGATTTGGG + Intronic
965540452 3:169866241-169866263 GGCAAGAGACAATGAGAGCTAGG + Intronic
967275377 3:187768940-187768962 GGAGAGAGACAATGGTGGCTTGG + Intergenic
968974460 4:3813955-3813977 GGGAAGACAGACTGCCAGCTAGG + Intergenic
970132194 4:12884469-12884491 TCAATGACAAAATGGCAGCTTGG + Intergenic
970151167 4:13092103-13092125 AGAATGACACAATGGACGCTGGG + Intergenic
971147743 4:23997178-23997200 GGAAAGAGACAGTGGCAGAATGG - Intergenic
971453249 4:26819517-26819539 GGAGAGAGTCAGTGGCAGCTTGG - Intergenic
971654827 4:29330915-29330937 GGAAATACATAATGGCCCCTAGG + Intergenic
974084239 4:57242445-57242467 GGCCAGAGACAATGGCATCTTGG + Intergenic
974144729 4:57933052-57933074 GGAAAGTAACAATGGAAGCAGGG + Intergenic
974464421 4:62236070-62236092 GGAAGGATGAAATGGCAGCTGGG + Intergenic
983206971 4:164920487-164920509 GAAAAAACAAAATGGCAGCCGGG - Intergenic
985821836 5:2165924-2165946 GGAAGGACACAAAGGCCACTTGG + Intergenic
988110358 5:26812174-26812196 GGAAAGAGGCAAAGGCAGCTAGG + Intergenic
988129435 5:27083545-27083567 GGAAAGCCACAATACAAGCTAGG - Intronic
989448156 5:41555085-41555107 GGAAAGAAACAATGACAGTATGG - Intergenic
990140723 5:52700003-52700025 GTATAGACACAGTGACAGCTAGG + Intergenic
990681881 5:58254182-58254204 GGAGAGAAAAAATGGTAGCTTGG - Intergenic
991394016 5:66184536-66184558 TGAAAACCAAAATGGCAGCTGGG - Intergenic
994083358 5:95731699-95731721 GGAGAGAGACAATGGCAGGACGG - Intronic
995970445 5:117963894-117963916 GCAGAGACATAGTGGCAGCTGGG - Intergenic
997258653 5:132448567-132448589 GGCAAGAGACAATGGTGGCTTGG - Intronic
998016390 5:138735499-138735521 GCAAAGGCACACAGGCAGCTGGG - Intronic
998549439 5:143063280-143063302 GGAAAGACACAATGGCAGCTTGG - Intronic
998625010 5:143836451-143836473 GGAAAGACATAATGGACTCTGGG + Intergenic
998884096 5:146676082-146676104 GTATTGAAACAATGGCAGCTGGG + Intronic
999514530 5:152287713-152287735 GGCAAGAGACAACGGTAGCTTGG - Intergenic
1000618666 5:163458883-163458905 TGAAAGACATTATGTCAGCTTGG - Intronic
1000939612 5:167344728-167344750 GGAAAGACACCATGGAAGCTAGG + Intronic
1001530642 5:172459123-172459145 GACAAGGCACAGTGGCAGCTGGG - Intergenic
1003260083 6:4509110-4509132 GGCAAGAGACAATGGCAGCTTGG - Intergenic
1004166965 6:13265377-13265399 GGGAAGCAAAAATGGCAGCTGGG + Intronic
1005502036 6:26437158-26437180 GGCAAGAAATGATGGCAGCTTGG - Intergenic
1005909555 6:30296389-30296411 GGAAAGACAGGATAGTAGCTAGG - Intergenic
1006189995 6:32201789-32201811 GGAAATACTCCATGGCAGCAAGG + Intronic
1008651291 6:53565699-53565721 GGTAAGACCAAATGGCAGATTGG + Intronic
1008901413 6:56621633-56621655 GGACAGAATCAATGTCAGCTGGG + Intronic
1009196961 6:60698177-60698199 GGAAACACAAAATGGCAGCCTGG + Intergenic
1009442315 6:63695697-63695719 GGAAAGAAATGATGGTAGCTTGG + Intronic
1010285276 6:74070096-74070118 GGAAAAACACAAAGGCAGGTTGG + Intergenic
1010344664 6:74798001-74798023 AGAAAGCAATAATGGCAGCTAGG + Intergenic
1012569310 6:100702166-100702188 GGAAAGACATGATGGTTGCTTGG + Intronic
1016039712 6:139420269-139420291 AGAAACTCACAATGGCAGCGTGG - Intergenic
1016536829 6:145116434-145116456 GGAAAGGAACAATGGCAGAAGGG - Intergenic
1016993348 6:149944361-149944383 GAGAAGTCACAATGCCAGCTGGG - Intronic
1017004984 6:150023169-150023191 GAGAAGTCACAATGCCAGCTGGG + Intronic
1017063925 6:150511172-150511194 GAAAGGAGACAATGGCAGCAGGG + Intergenic
1017632063 6:156405943-156405965 GGAAATACACAAGAGCAGCCTGG + Intergenic
1024467346 7:49725720-49725742 AGAAAAATACAATGGCAGATAGG - Intergenic
1024502838 7:50131146-50131168 GGACAGAGATAATGGTAGCTTGG + Intronic
1026500220 7:70937462-70937484 GGTATGATACAATGGCAGCTTGG + Intergenic
1027235982 7:76298008-76298030 GGTAAGACAGAAAGGCATCTAGG + Intergenic
1027422719 7:78033097-78033119 GGCAAGACATGATGGTAGCTTGG + Intronic
1028611414 7:92716327-92716349 GGAAAGACAGAAAGGTAGGTTGG + Intronic
1029930246 7:104363211-104363233 GGAATGAACCAAGGGCAGCTTGG + Intronic
1029931250 7:104373672-104373694 GGAAAAACTCAAAGGCAGGTGGG + Intronic
1030991816 7:116310110-116310132 GGCAAGAGATAACGGCAGCTTGG + Intronic
1031478669 7:122252261-122252283 GGATAGAGACAATGGAAGATGGG - Intergenic
1033816867 7:145083681-145083703 GGAAAAAAAAAATGGCAGATAGG - Intergenic
1033921727 7:146401393-146401415 GGAAAAGAACAAAGGCAGCTAGG + Intronic
1034449283 7:151128823-151128845 GGAACCTCACACTGGCAGCTTGG + Intronic
1036018522 8:4815275-4815297 GGAAGGACACAAATGCAGATTGG - Intronic
1037559517 8:20060234-20060256 GGCAATACCCAATGGCAGGTTGG + Intergenic
1038278480 8:26141643-26141665 GGAGAGATACTATGGCACCTGGG + Intergenic
1038485416 8:27931598-27931620 TGAAAGAGACCATGGCAGCAAGG + Intronic
1039135331 8:34316365-34316387 GAAAATACAAAATGGCAGCCAGG + Intergenic
1039403444 8:37292807-37292829 GGAAAGAAAGAAGGGCAACTGGG + Intergenic
1039925667 8:41929618-41929640 GGAGAGATACAAAGGCATCTAGG + Exonic
1040981881 8:53252488-53252510 GGCAAGACACAAAGGGAGCAAGG + Intergenic
1041452624 8:58022929-58022951 TGAAAGACACACAGGCTGCTGGG - Intronic
1041803792 8:61827956-61827978 GGAAAGGCAGAAAGGCAGATGGG + Intergenic
1042436232 8:68768262-68768284 GGAAATATACAATGTAAGCTTGG - Intronic
1043404675 8:79918157-79918179 GGCAAGAGATGATGGCAGCTTGG - Intergenic
1045203223 8:100009060-100009082 GGAAAGACTTAATGGCAGAAAGG - Intronic
1047410338 8:124619434-124619456 GTAAAGAGACAATGGCAGGACGG - Intronic
1047772250 8:128038952-128038974 ACAAAGACACAATGGCTGCAAGG - Intergenic
1048569860 8:135643213-135643235 GGACAGAGGCAATGGCAGCAAGG - Intronic
1049394754 8:142394797-142394819 GGACAGGCACGCTGGCAGCTGGG - Intronic
1049627596 8:143632751-143632773 GGAAAGACACGTTGGCTGCGTGG - Intergenic
1049808331 8:144551533-144551555 GCACAGATACAGTGGCAGCTAGG + Intronic
1052815572 9:33100333-33100355 AGAAATACAAAATGGCAGCTTGG + Intergenic
1053688714 9:40568738-40568760 GGCAGGGCACAATGGCAGCTGGG - Intergenic
1054275320 9:63062319-63062341 GGCAGGGCGCAATGGCAGCTGGG + Intergenic
1054299954 9:63369649-63369671 GGCAGGGCACAATGGCAGCTGGG - Intergenic
1054399511 9:64702612-64702634 GGCAGGGCGCAATGGCAGCTGGG - Intergenic
1054497291 9:65834798-65834820 GGCAGGGCGCAATGGCAGCTGGG + Intergenic
1055875360 9:80935491-80935513 GGAAAGAGATAATGGCTGGTGGG - Intergenic
1056923174 9:90809952-90809974 GGAAAGGCAGCTTGGCAGCTGGG + Intronic
1058644614 9:107119070-107119092 GGAAAGAGACAAGGGGAGCGTGG + Intergenic
1061064661 9:128269891-128269913 GCAAAGATGCAAAGGCAGCTTGG - Intronic
1061615269 9:131774995-131775017 GGACAGACAGAACGGCAGCCAGG + Intergenic
1185912282 X:3993242-3993264 GGAAAGACACGTTGGGAGCTTGG - Intergenic
1186134423 X:6504355-6504377 TGTAAGACATAATGGCAGCTTGG - Intergenic
1186512577 X:10141077-10141099 GGAAGGACACACTGGCACATAGG - Intronic
1186705046 X:12132110-12132132 GGAGAGAGACAATGGAGGCTTGG + Intergenic
1187032896 X:15506252-15506274 GGAAAGACTGAATAGCACCTTGG + Intronic
1187124529 X:16441943-16441965 GGAAAGAGAGAATGGCAACTTGG - Intergenic
1188025259 X:25201607-25201629 GGCAAGAGATAATGGTAGCTTGG + Intergenic
1188554581 X:31397559-31397581 CGAAAGACACAATGGAATCTAGG - Intronic
1189600558 X:42620484-42620506 AGAAAGACACAAAGGCAGAGAGG + Intergenic
1190470920 X:50778597-50778619 TGAAAGACACAAGGACAGTTTGG - Intronic
1190626086 X:52340131-52340153 GGGAAGACACATTTGCTGCTTGG + Intergenic
1191917105 X:66214240-66214262 GGTAAGAGATGATGGCAGCTTGG + Intronic
1194691187 X:96987304-96987326 GGACAGCCTCAATGGCCGCTTGG - Intronic
1194806210 X:98331355-98331377 GGAATGACACAATGGACTCTGGG + Intergenic
1195950390 X:110265899-110265921 TGACAGCCACAATGGCAGATAGG + Intronic
1196404007 X:115345756-115345778 GGAAAGTCAGAATGGCAGAGGGG + Intergenic
1197121872 X:122903143-122903165 GGAAGGAAACAATAGCAACTAGG + Intergenic
1197363432 X:125535628-125535650 GGAAAGAAATGATGGCAGATGGG + Intergenic
1199109976 X:143920470-143920492 GGAAAAACACAGTGACAGATTGG + Intergenic
1202126682 Y:21574569-21574591 GGAGAGAAAAAATGGCAGTTGGG + Intergenic