ID: 998553128

View in Genome Browser
Species Human (GRCh38)
Location 5:143096854-143096876
Sequence TTAGGACAGTGGTTCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 1, 2: 6, 3: 49, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998553128_998553131 10 Left 998553128 5:143096854-143096876 CCAACAGAGAACCACTGTCCTAA 0: 1
1: 1
2: 6
3: 49
4: 314
Right 998553131 5:143096887-143096909 AATCACAAAATAGCTTTGTATGG 0: 1
1: 0
2: 3
3: 16
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998553128 Original CRISPR TTAGGACAGTGGTTCTCTGT TGG (reversed) Intronic
901429015 1:9201150-9201172 TTGGGACAGTGGCTCTTTCTGGG - Intergenic
902281848 1:15380418-15380440 CTAGAACAGTGGTTCTCAATTGG - Intronic
903282649 1:22258719-22258741 TGAGGAAAGTGGGGCTCTGTTGG + Intergenic
903456845 1:23493422-23493444 TTAGGACATTGGATATCTTTTGG + Intergenic
904229114 1:29052352-29052374 TTAGGGCAGTGGTTCTCAACTGG - Intronic
904718578 1:32488507-32488529 GTAGGACAGTGATTCTCAGTTGG + Exonic
905302733 1:36996839-36996861 GTAGGACAGTGGCTCTCAATCGG + Intronic
905464488 1:38142329-38142351 TGAGGAAAGGGGATCTCTGTGGG + Intergenic
905664137 1:39752150-39752172 TTAGGGCACTGCTTCTCAGTGGG - Intronic
906280479 1:44549981-44550003 TGAGGACAGGGCTTCTCTGGTGG - Intronic
906369341 1:45239358-45239380 TCAGAACAGTGGTTCTCTCTGGG + Intronic
906611975 1:47209769-47209791 TTAGGACAGGACTTCTCTGAGGG - Intergenic
907558051 1:55362322-55362344 TCAGGACAGTGGTTTCCTCTGGG + Intergenic
908661259 1:66437944-66437966 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
908666753 1:66501038-66501060 TTGGGACAGTATTTCTATGTGGG + Intergenic
909697218 1:78481282-78481304 TCAGGATAGTGGTTATCTGGGGG + Intronic
911243701 1:95493502-95493524 TTATCACAGTGCTTCTCTTTGGG - Intergenic
913132074 1:115849190-115849212 GTAGAACAGTGGTTTCCTGTGGG - Intergenic
913272992 1:117112302-117112324 TTAGGACTGTGGCTCTCTGATGG - Exonic
915472395 1:156133821-156133843 TCATGACAGTAGCTCTCTGTAGG + Intronic
915725293 1:158013042-158013064 TTAGCTCAGTGGTTCTCACTTGG - Intronic
916001184 1:160617652-160617674 TCAGGATAGTGGTTATCTTTGGG + Intronic
916836008 1:168545715-168545737 TTAGCAAAGAGGTTCTCAGTAGG - Intergenic
916838459 1:168574859-168574881 TTAGTAAAGAGGTTCTCAGTAGG + Intergenic
916948436 1:169755053-169755075 GTAGGACACAGGTTCTCTGCAGG + Intronic
918164011 1:181927071-181927093 TTAGGACACAGGTGCTTTGTTGG - Intergenic
918215286 1:182388229-182388251 TTAGAGCAGTGGTTTTCTGAGGG + Intronic
919665934 1:200291979-200292001 TTTGGACAGTGGTTGGCTGCAGG - Intergenic
920846206 1:209595128-209595150 TTAGAAGAGTTGTTCTCTGCTGG + Intronic
921180438 1:212627506-212627528 TCAGGACAGTGGTTTTCTCTGGG + Intergenic
922012434 1:221604206-221604228 TCAGAACAGTAGTTATCTGTGGG + Intergenic
922438654 1:225632200-225632222 GTAGAACAGTGGTTCTCAGCTGG + Intronic
924028666 1:239865319-239865341 TTAAGACATTGGTTGTCTGTGGG + Intronic
924671093 1:246126197-246126219 TTAGATCAGTGGTTCTCACTGGG + Intronic
1062888831 10:1040258-1040280 GTAGGACAGTGGTCCTCAGTTGG + Exonic
1067958942 10:50825846-50825868 TTAGGCCAGTGGTTCTCAACTGG + Intronic
1068147697 10:53092155-53092177 TTATGCCAGTGTTTCTCTCTAGG - Intergenic
1068879076 10:62029600-62029622 TGAGGAAACTGGTTGTCTGTAGG + Intronic
1070914792 10:80145973-80145995 TTAGGACTGTGGTTGACTGCAGG - Intergenic
1071599805 10:86953529-86953551 TTAGACCAGTGGTTCTCAATGGG + Intronic
1071719725 10:88131263-88131285 TTAGGTTAGTGGTTCTCCGCTGG + Intergenic
1072504462 10:96050786-96050808 TTAAGACAATGGTTCTCAATTGG - Intronic
1072951651 10:99851860-99851882 TCAGGACAGTGGTTGTCCCTGGG - Exonic
1073514630 10:104065491-104065513 TGTGGACAGTGGGTCTCTGGAGG - Intronic
1074125931 10:110529011-110529033 TGCTGACAGTGGTTTTCTGTGGG - Intergenic
1075306200 10:121369924-121369946 TTAAGTCAGTGGTTCTCACTAGG + Intergenic
1076486376 10:130821312-130821334 TTAGGACAGTGGTTCCCCTGGGG + Intergenic
1077248333 11:1549725-1549747 TAAGAAGAGTGGTTCTTTGTGGG - Intergenic
1077658433 11:4044824-4044846 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
1077821044 11:5740800-5740822 TTAGTACAGTGGTTCCATCTTGG - Intronic
1079385156 11:19972245-19972267 TGAGAACACTGGTTGTCTGTAGG - Intronic
1080515858 11:33019336-33019358 TTAACCCAGTGGTTCTCAGTGGG - Intronic
1080767348 11:35309170-35309192 TTAAGACAGGTGTTCTCTGAGGG - Intronic
1081202541 11:40234938-40234960 TTAGTACGGTGGTTCTCAATGGG - Intronic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1085635862 11:78159039-78159061 TCAGCACAGTGCTTGTCTGTGGG + Intergenic
1086207207 11:84273841-84273863 TTAAGACAGTAATACTCTGTAGG - Intronic
1086410334 11:86538679-86538701 TTAGTACTGTAGTTCCCTGTGGG + Intronic
1088440826 11:109868162-109868184 TTAGGACAAAGGTTCTCAGTGGG - Intergenic
1089745973 11:120617031-120617053 TTAGGACAGGGGTTCTCCTGGGG + Intronic
1093122501 12:15289376-15289398 TTTGGACTGTGGTTGACTGTGGG + Intronic
1093154471 12:15665042-15665064 TCAGGACAGTGGTTGGCTGCTGG - Intronic
1093167863 12:15825901-15825923 TTATGATAGTGGTTCTTTCTAGG - Intronic
1094158407 12:27362580-27362602 TCAGAACAGTGGTTCTCTTCGGG - Intronic
1095758310 12:45796353-45796375 TTAGTATAGTAGTTCCCTGTTGG + Intronic
1095986924 12:48004973-48004995 TTAGGACTCTGAATCTCTGTGGG - Intergenic
1096375688 12:51108336-51108358 TTATGACAGTGGTTTCCTCTGGG + Intronic
1096988744 12:55780915-55780937 TTAGGACTGTGGTTGACTGAGGG + Intronic
1097899299 12:64857335-64857357 TTAAGGCAGGGGTTCTCTTTTGG + Intronic
1099279194 12:80622369-80622391 TTAGGTCAGTGCTTCTCAGAGGG + Intronic
1100648465 12:96558023-96558045 TTAGGACAGTGGTTCCTTTGTGG + Intronic
1100668517 12:96783404-96783426 TTAGAACAGTGGTTGTCTCTGGG - Intronic
1101131457 12:101695460-101695482 TTTGGACTGTGGTTGACTGTGGG + Intergenic
1101686442 12:107027504-107027526 TGAGGACTGTGCTTCTATGTAGG - Intronic
1102711944 12:114935873-114935895 CTTGGACAGTGGTGCTCAGTTGG - Intergenic
1103627524 12:122231489-122231511 CTAGGACAGTGGTTAAGTGTTGG - Exonic
1104422990 12:128652406-128652428 TTAGCACAGGAGTTCTTTGTTGG - Intronic
1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG + Intronic
1104747922 12:131221575-131221597 TTAGGACAGGCGCTCTCTGTGGG + Intergenic
1105940659 13:25145397-25145419 TCAGGACAGCGATTCTCTCTAGG + Intergenic
1109350737 13:61177972-61177994 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
1109446758 13:62449379-62449401 TTGGGATAGTGGTTATCTTTAGG + Intergenic
1109773453 13:67007410-67007432 TTAAGACAGTGGGTTTCTGAGGG + Intronic
1110777727 13:79429475-79429497 TTAGAACAGTGGTTGTCTATGGG - Intergenic
1111650203 13:91080945-91080967 TTAGGGCAGTGGTTCTCAATGGG - Intergenic
1112160669 13:96864147-96864169 TTAGGATGGTGGTTATTTGTGGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1113042026 13:106114597-106114619 TTGGGAGAGTGGGTATCTGTGGG + Intergenic
1113176004 13:107564766-107564788 ATAGGACAGGGCTTCTCTTTGGG + Intronic
1113382250 13:109814429-109814451 TTAGCACAGTGGTTCTCAATTGG + Intergenic
1113638819 13:111942826-111942848 TTATGCCAGTGGTTCTCAATTGG - Intergenic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1117520960 14:56550930-56550952 TTGGGACAGTGGTTTTATGTAGG + Intronic
1117973063 14:61271217-61271239 TTAGGAGAGTGGTTATCCCTGGG - Intronic
1121082666 14:91120866-91120888 TTACGACAGAGGGTCTCTGAGGG + Intronic
1124366526 15:29075550-29075572 TTAGAACAGTGGTTCTCAACTGG - Intronic
1125758866 15:42083844-42083866 TTGGGACAGTGGGTCTCAGAGGG - Intronic
1126391576 15:48160975-48160997 TTAGGACAGTGGCTACCTATGGG + Intronic
1127077136 15:55337983-55338005 TTAGGATAGTGGTTACCTTTGGG + Intronic
1127148499 15:56050009-56050031 CTAGGACAGTGGTTTTCCATGGG - Intergenic
1127369823 15:58329387-58329409 GTAGAACTGTGGTTCTCTGAGGG + Intronic
1127604035 15:60568166-60568188 ATAGGACAGTGGTGCTCTGCTGG + Intronic
1128197130 15:65768482-65768504 TCAAGATAGTGGTTCTCTTTGGG - Intronic
1129346053 15:74920029-74920051 TTAGGGGACTGGTTGTCTGTGGG - Exonic
1129510452 15:76117875-76117897 TTAGGCCAGTGATTCTCAGGTGG + Intronic
1130429917 15:83837387-83837409 TTAGGACAGTGGTTGTTTTGGGG + Intronic
1131102235 15:89701828-89701850 TTAGGCCAGTCCTTCTCTGTTGG - Exonic
1131863974 15:96686969-96686991 TCAGGACGGTGGTTATCTCTTGG + Intergenic
1132250026 15:100329070-100329092 TAATTAAAGTGGTTCTCTGTGGG + Intronic
1132508547 16:325007-325029 GTAGGACTGTGGTTCTGTGCGGG - Intronic
1133551053 16:6855013-6855035 TAAGGACAATGTTTCACTGTTGG + Intronic
1133710223 16:8393976-8393998 TTAGGGAAGTGGTTCTCACTGGG - Intergenic
1134145499 16:11757520-11757542 TTAGCACAGTGGTTCTCAACTGG - Intronic
1134830865 16:17321674-17321696 TTAGAGCAGTGGTTCTCAATCGG + Intronic
1135078643 16:19415333-19415355 TTAGAGCAGTGGTTCTCAGGGGG + Intronic
1135583444 16:23648003-23648025 TCAGGACAGCGGTTTTCTCTTGG - Intronic
1137741069 16:50774781-50774803 TTTGGACAGTGGTTGACTGTGGG + Intronic
1137864355 16:51877750-51877772 TTAGGGCAGTGGTTCTCAATTGG + Intergenic
1138126753 16:54445328-54445350 TTTGGACTGTGGTTGACTGTGGG - Intergenic
1139331299 16:66193899-66193921 TGAGAATAGTGGTTCTTTGTGGG + Intergenic
1139718776 16:68836155-68836177 ACAGGCCAGTGGTTCTCTGCTGG + Intergenic
1140139979 16:72246343-72246365 TCAGGACACTGGTTTGCTGTTGG + Intergenic
1142545573 17:699909-699931 CTAGGACAGTGGTTATCTCTGGG + Intronic
1142891439 17:2946671-2946693 ATAGGTCAGTGGTTCTCACTTGG + Intronic
1143232138 17:5365704-5365726 TTAGGACAGTGGCTGCCTGTCGG - Intronic
1144163215 17:12581871-12581893 TGATGACAGTGGCTCTCGGTGGG - Intergenic
1144335171 17:14262156-14262178 CTAAGACAGTGGTTCTCACTGGG - Intergenic
1148979723 17:51562133-51562155 TTGGGTCAGTAGTTCTCAGTGGG + Intergenic
1150962889 17:69934344-69934366 TTTATACAGTGGTTCTCAGTGGG - Intergenic
1152814725 17:82400593-82400615 TCAGGACTGTGGTTACCTGTAGG + Intronic
1153995238 18:10434561-10434583 CTAGGACAGTGGTTCTCCAAGGG + Intergenic
1154199399 18:12288723-12288745 TTAGCAAAGTGGCTCTCTCTAGG - Intergenic
1154463548 18:14620403-14620425 GTAGGCCAGTGGTTCTCTGGGGG - Intergenic
1156602243 18:38622632-38622654 TTAGAAAAGTGGTTTTCTCTTGG + Intergenic
1157721278 18:49926456-49926478 TTAGGACAGAGGGTCCCAGTGGG + Intronic
1157880685 18:51318493-51318515 TTAGGGGAGTGGTTCCGTGTGGG - Intergenic
1158433230 18:57411319-57411341 TTTGGACTGTGGTTAACTGTGGG - Intergenic
1158510387 18:58085203-58085225 TGAGAACAATGGTTATCTGTTGG + Intronic
1158978843 18:62738797-62738819 TTTGGACTGTGGTTGGCTGTGGG + Intronic
1159455264 18:68653181-68653203 TCAGGACAGTGGTGACCTGTGGG + Intergenic
1159557349 18:69959220-69959242 TTAGGACATCTGTTCTCTGGAGG - Intronic
1162451019 19:10754998-10755020 TCAGGGCAGTGGTTCCCTTTCGG - Intronic
1164562821 19:29304586-29304608 TGAGGAAAGGGGTCCTCTGTGGG - Intergenic
1164841086 19:31392896-31392918 TTGGGACAATGGCTCTCTTTCGG - Intergenic
1164943680 19:32271629-32271651 TCAGGACAGTAGTTATCTTTGGG - Intergenic
1166015945 19:39979606-39979628 TTAGGCCACTGGGTCACTGTGGG + Intronic
1166053005 19:40271900-40271922 TTAGGACAGCGGTTGTCAGCTGG - Intronic
1166161594 19:40957725-40957747 GTAGGACCTTGGTTGTCTGTTGG - Intergenic
1168070699 19:53949634-53949656 TTAGGACAGTGGCTCTCAACTGG + Intergenic
1168428956 19:56262007-56262029 TTAGAAAAGTGGTTACCTGTAGG - Intronic
1168435461 19:56313920-56313942 TTAGGGCAGCAGTTCTCAGTAGG + Intronic
1168456950 19:56519753-56519775 TTTGGACAGTGGTGGACTGTGGG - Intronic
925013890 2:507155-507177 ACAGGAGAGAGGTTCTCTGTTGG + Intergenic
925507816 2:4588465-4588487 GTATGACAGTGGATCTCTGTGGG + Intergenic
926234642 2:11030015-11030037 TCAGGACAGTGGTCACCTGTCGG - Intergenic
927003944 2:18828068-18828090 TAAGGGCAGTGGGTCTCTCTTGG + Intergenic
927015134 2:18951464-18951486 ATAGGAAAGTGGTTTTCTTTTGG - Intergenic
928647669 2:33371800-33371822 TTCGGACCGTGGTTGACTGTGGG - Intronic
929392060 2:41480921-41480943 TTAGGACAATGGTTCTCAATTGG - Intergenic
931081546 2:58777607-58777629 TTACAACAGTGATTCTCAGTTGG - Intergenic
931801437 2:65762023-65762045 ATAGAACAGTGGTTCTCAGTTGG + Intergenic
932800432 2:74737557-74737579 GTAGGACCGTGGTTCTCAGTAGG + Intergenic
937110251 2:119361227-119361249 TTTGGACAGTGGTTGGCCGTGGG - Intronic
938620371 2:133046136-133046158 TTTGGACCATGGTTGTCTGTGGG + Intronic
938970137 2:136424282-136424304 CTAGGACAGTGGTTTCCTGTAGG + Intergenic
939137019 2:138308856-138308878 GTAGGACAGTGGTTCTCAGTTGG - Intergenic
939442759 2:142271215-142271237 TTAGGTCAAGAGTTCTCTGTTGG - Intergenic
940273596 2:151916749-151916771 TTAGAACAGTGGTTCCCAGCTGG + Intronic
942606541 2:177697895-177697917 TTAGAACAGTGGTTCTCAGCTGG + Intronic
944025415 2:195160222-195160244 TGAGGACAGTGGTTGCCTTTGGG + Intergenic
944142511 2:196472575-196472597 TCAGAATAGTGGATCTCTGTAGG + Intronic
944145914 2:196507379-196507401 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
944207746 2:197174594-197174616 TCAGGACAGTGGTTCCCCCTGGG + Intronic
945005852 2:205405179-205405201 CTAGAACAGTGGTTCTCAATGGG + Intronic
945062445 2:205921063-205921085 TAGGGACAGTGGTTCTCGTTGGG - Intergenic
945220513 2:207478834-207478856 GTAAGACAGTGGTTCTCAATGGG + Intergenic
945259909 2:207833744-207833766 TTAGGTCAGTGGTTCTCAACAGG - Intronic
947173386 2:227335583-227335605 ATAGGTCAGTGGTTTTCAGTAGG - Intronic
1169159291 20:3362736-3362758 TTAAGTCAGTGGTTCTCAGTCGG - Intronic
1169162280 20:3391135-3391157 TTAGGACAGTGTTTATCTCTGGG - Intronic
1169546902 20:6659714-6659736 TTAGAACAGTGCTTCTCAATAGG - Intergenic
1169965463 20:11212867-11212889 TAATAACAGTGGTTCTCAGTGGG - Intergenic
1170046323 20:12089188-12089210 TCAGAACAGTAGTTCTCGGTAGG - Intergenic
1170816160 20:19716189-19716211 TTAGAGCAGTGGTTCTCAGAGGG - Intronic
1171446451 20:25207683-25207705 TTAGGCCAGTGGTTGTGTTTGGG + Intronic
1172829581 20:37821951-37821973 CTATGACAGTGGTTCTCAGTTGG - Intronic
1173499539 20:43542704-43542726 TTAGAAAAGTGGTTGTCTTTTGG - Intronic
1173943367 20:46931062-46931084 TGAGGACAGTGGTTCTCAATTGG - Intronic
1173968403 20:47131375-47131397 TTAGGGCAGTGGTTCTCGGCAGG - Intronic
1174233142 20:49063996-49064018 TTAGGACAGTGATTCTCAACTGG + Intronic
1175474655 20:59263158-59263180 TTAAGGCAGTGGTTCTCAGAGGG + Intergenic
1175483609 20:59328922-59328944 TCATGACAGTGGTTTTCTGGGGG - Intergenic
1175536032 20:59713431-59713453 TTAAGACAGTGGTTCTCTCTGGG - Intronic
1176810976 21:13537969-13537991 GTAGGCCAGTGGTTCTCTGGGGG + Intergenic
1178451405 21:32704737-32704759 ATAGGAGAGTGGTTATCTATGGG + Intronic
1178786172 21:35655801-35655823 TTAGGACCTTGGTTTTCTGCAGG + Intronic
1179355814 21:40658099-40658121 TTGGAACCCTGGTTCTCTGTGGG - Intronic
1179827630 21:43975867-43975889 TTAGCAAAGTGATTCTCTGACGG + Intronic
1182404969 22:30119158-30119180 TTATAATAGTGGTTTTCTGTAGG - Intronic
1182610351 22:31542169-31542191 TAATGCCAGTGGTTCTCTCTCGG - Intronic
1182655011 22:31883198-31883220 CTAGGACAGCGGTTCTCAGCTGG - Intronic
1182876903 22:33700127-33700149 TAAGGACAGTGGTTCTCAAAGGG + Intronic
1183040384 22:35173399-35173421 CCAGGACAGTGGTTCTCAGTTGG - Intergenic
1183386128 22:37515802-37515824 TTATGACTGTGGTTCTCAATGGG - Intronic
1183472763 22:38018347-38018369 TTAGGATAATGGTTCACTCTGGG + Intronic
1183888619 22:40906490-40906512 GTAGGTCAGTGATTCTCAGTGGG + Intronic
949329883 3:2909883-2909905 TTAGGATAGTGGTTCTCAAACGG - Intronic
949794474 3:7833277-7833299 TTAGGACAATGGTTATCCTTAGG + Intergenic
950223967 3:11218498-11218520 TCAGGACAGTGGTTTCTTGTGGG + Intronic
950671949 3:14532592-14532614 ATAGAGCAATGGTTCTCTGTTGG - Intronic
951013938 3:17708666-17708688 TTAGAACAGTGGTTCTGAATAGG - Intronic
952305246 3:32139937-32139959 TCAGGACAGTGGTTCACCCTGGG + Intronic
952536326 3:34313302-34313324 TCAGAACAGTGGTTATCTTTGGG - Intergenic
953989100 3:47470236-47470258 TTAGGCCAATGGTTATATGTAGG + Intronic
954422928 3:50428090-50428112 TTAGGCCAGTGGTTCTCAACTGG + Intronic
954812849 3:53258459-53258481 TTAGGACAGTGGCTCCCTAAGGG - Intergenic
955279744 3:57582911-57582933 TTAGAACAGTGGTTCTCAGCAGG + Intronic
955457025 3:59134076-59134098 TTAGGACACTGGATTTCTTTGGG - Intergenic
955531080 3:59873743-59873765 CTAGACCAGTGGTTCTCAGTTGG - Intronic
956090738 3:65663893-65663915 ATAGGTCAGTGGTTCACAGTGGG - Intronic
956685323 3:71821533-71821555 TTGTGTCAGTGGTTCTCAGTGGG - Intergenic
957171202 3:76738580-76738602 GTAGCACAGTGGTTCTCACTGGG - Intronic
957582615 3:82093634-82093656 GTAGGACAGTTGTTTTCTTTTGG + Intergenic
959256991 3:104028054-104028076 TTAGGACAGTGATACTGTTTAGG - Intergenic
961989730 3:131175569-131175591 TTAGGCCAGTGGTTGCCTGGGGG + Intronic
962076227 3:132084646-132084668 TTAGGACAGTGGTTACCTTGTGG - Intronic
962418528 3:135206050-135206072 TTAGAACAGTGGTTGCCTCTGGG - Intronic
962896412 3:139718823-139718845 CTAAGGCTGTGGTTCTCTGTGGG - Intergenic
962994962 3:140617379-140617401 TAAGTACAGTGGTTTTGTGTTGG - Intergenic
963569371 3:146972710-146972732 CTAAGATAGTGGTTCTCTTTGGG - Intergenic
963711780 3:148755028-148755050 TCAGGACAGTTGTCCTCTGCTGG - Intergenic
963756769 3:149242610-149242632 TTAGTACAGTGGTTCTCTACAGG + Intergenic
964518404 3:157538106-157538128 TTAGGACAGTGGTTACTTGTGGG + Intergenic
965197457 3:165620214-165620236 ATAGGACAGTGGTTCTCAGTTGG + Intergenic
965573716 3:170196885-170196907 TTTGGACTGTGGTTGACTGTAGG - Intergenic
965872149 3:173276508-173276530 TTAGGATAGTGGTTCCTTCTGGG - Intergenic
967372897 3:188768781-188768803 TTAGAATAGTGGCTCTCTCTGGG - Intronic
968466941 4:757078-757100 TGATCACAGTGGTTCTCTATAGG - Intronic
973184334 4:47306584-47306606 TTAGAATAGTGGTTATCTCTGGG - Intronic
973843126 4:54882818-54882840 TTAGAACAGTGGTTGCCTGTAGG - Intergenic
974091693 4:57317754-57317776 TTAGCTCAGTGGTTTTCTGAAGG + Intergenic
974258233 4:59489810-59489832 TTAGAAGAGTTTTTCTCTGTGGG + Intergenic
977007627 4:91590991-91591013 TTAGGGCAGTGGTTCTCAACTGG + Intronic
980536260 4:134127342-134127364 TTAGTACACTGGTTTTGTGTTGG - Intergenic
980762784 4:137257854-137257876 CTAGGACAGTAGTTCTCTCAGGG + Intergenic
981907038 4:149933179-149933201 TTAGGATTGTGGTTGACTGTGGG - Intergenic
983053609 4:163076923-163076945 TAAGGACAGTGGTTACCTTTGGG + Intergenic
983729806 4:170979134-170979156 TAAGCACACTGGTTTTCTGTTGG + Intergenic
984270190 4:177540139-177540161 TTAGGATAGTGGTTATCCTTGGG + Intergenic
984657760 4:182337947-182337969 TCAGGACAGTGGTTGCCTGTTGG + Intronic
984737468 4:183123538-183123560 TCAGGATAGTGGTTTTCTGTGGG + Intronic
985795205 5:1956721-1956743 TTTGGTGAGTGGATCTCTGTGGG + Intergenic
987822012 5:22977671-22977693 TTTGGACTGTGGTTGACTGTAGG + Intergenic
989968572 5:50494325-50494347 TTAGGACTGTGTTTGTCTGCTGG + Intergenic
991463130 5:66880307-66880329 TTAGAACAGTGGTTCTCTCTGGG + Intronic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
994851714 5:105063314-105063336 CTAGGCCAGTGCTTCTCTGAGGG - Intergenic
995264498 5:110141745-110141767 TTAGGAGAGTGGTTTTGTGAAGG + Intergenic
995732058 5:115256095-115256117 TGAGAACAGTGGTTCTCTACTGG + Intronic
997371192 5:133361688-133361710 CTAAGACAGTGGTTCTAAGTGGG + Intronic
998311188 5:141134683-141134705 TCAGGACAGTGCTTATCTTTTGG + Intronic
998553128 5:143096854-143096876 TTAGGACAGTGGTTCTCTGTTGG - Intronic
1000068469 5:157717761-157717783 TTGAGACAGTGTTGCTCTGTTGG + Intergenic
1000253276 5:159514896-159514918 CTAGGGCAGTGGTTCTGAGTTGG + Intergenic
1000546061 5:162604282-162604304 TTAGGACAGTGGTTCCACCTTGG - Intergenic
1001257243 5:170193344-170193366 TTATGTCAGTGCCTCTCTGTGGG - Intergenic
1001423333 5:171603685-171603707 TCAGGACAGTGCTTCCCTCTGGG - Intergenic
1002255273 5:177953714-177953736 TTAGAACAGTGGGGCTTTGTGGG + Intergenic
1002482863 5:179515020-179515042 TTAGAACAGTGGGGCTTTGTGGG - Intergenic
1002618920 5:180472706-180472728 ATAGTGCAGTGGTTCTCAGTTGG + Intergenic
1003295119 6:4819683-4819705 TTATGACAGTGGTTTTCAGAGGG + Intronic
1006028988 6:31165461-31165483 TTGGTGCAGTGGTTCTCAGTGGG - Intronic
1006550472 6:34818690-34818712 TTAGGAAAGTGCTTACCTGTGGG - Intronic
1006664464 6:35681441-35681463 TCAGGACAGTGGTTGCCTCTGGG - Intronic
1006952585 6:37836132-37836154 TTAGATCAGTGATTCTCTGTGGG + Intronic
1007833785 6:44658693-44658715 TTAGGAGAGTGGTTCTCTGGGGG - Intergenic
1008081778 6:47202815-47202837 TTTGGACAGAAGTTCCCTGTGGG - Intergenic
1008129673 6:47706487-47706509 ATAGGACAGTGGTTCTCAACTGG + Intronic
1010168250 6:72942053-72942075 TCAGGCCACAGGTTCTCTGTAGG - Intronic
1010316175 6:74453306-74453328 TTATAACAGTGCTTCTCTGTGGG + Intergenic
1010392773 6:75356075-75356097 CTAGAACAGTGGTTCTCAATTGG - Intronic
1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG + Intergenic
1013455363 6:110324967-110324989 TCAGGAGAGTTGTTCTCTTTAGG + Intronic
1013469294 6:110447293-110447315 TCAGGACTTTGGCTCTCTGTGGG + Intronic
1013886038 6:114968816-114968838 TTAGGATTGTGGATCTCTATAGG + Intergenic
1014131456 6:117838907-117838929 GTAAGTCAGTGGTTCTCAGTGGG - Intergenic
1014348011 6:120300096-120300118 ATAGGATAGTGGTTACCTGTAGG + Intergenic
1015005347 6:128273527-128273549 TGGGGACAGTGGATCTCAGTAGG - Intronic
1015815957 6:137211015-137211037 TTATTGCAGTGGTTCTCTGTGGG + Intronic
1015818501 6:137235196-137235218 TGAGGACAAGGGTTCCCTGTAGG - Intergenic
1016309697 6:142720738-142720760 ATAGGAGAGGGGTTCTCTGATGG - Intergenic
1017083482 6:150691505-150691527 TTAGGCCAATGGTAGTCTGTAGG - Intronic
1018047052 6:159974792-159974814 GTAGGCCAGTGGTTCTCAATTGG - Intronic
1018847486 6:167565677-167565699 CTAGCACAGTGCATCTCTGTTGG - Intergenic
1019123419 6:169823713-169823735 TTAGTGCAGTGGTTTTATGTTGG + Intergenic
1019123421 6:169823748-169823770 TTAGTGCAGTGGTTTTATGTCGG + Intergenic
1019958830 7:4439679-4439701 CCAGCTCAGTGGTTCTCTGTAGG + Intergenic
1021339381 7:19444672-19444694 TTAGAACAGTGGTTCTCATCTGG + Intergenic
1022123719 7:27335484-27335506 TTAGGACAGTGGTTAGCCTTGGG - Intergenic
1022331748 7:29385717-29385739 TTAGGCCAGTGGTTCTCAACTGG - Intronic
1022951712 7:35345596-35345618 TCAGAACAGTGGTTTTCTCTTGG + Intergenic
1023815069 7:43943347-43943369 TTAGGACAGGGGTTCTCAGCCGG + Intronic
1024175125 7:46832173-46832195 TTTGGACTGTGGTTGACTGTGGG - Intergenic
1024201123 7:47106691-47106713 TCAGGAGGGTGGTTCTCTTTGGG - Intergenic
1024524674 7:50337762-50337784 TTAGGTCACTGTTTCTCAGTGGG + Intronic
1026420437 7:70231373-70231395 TCAGGACAGTGGTTAACTCTGGG - Intronic
1028610452 7:92704467-92704489 TTAGGATAGTGGTTGCCTGTGGG - Intronic
1028763667 7:94525356-94525378 TTAGGAGAGTGGTTTACTTTGGG + Intronic
1029644533 7:101845497-101845519 TAAGGCCAGTGGGTCTCAGTAGG - Intronic
1031283017 7:119828906-119828928 TCAGCACAGTGGTTATCTATTGG - Intergenic
1031897389 7:127366791-127366813 TTGGGACAGTTGCTCTCTCTTGG - Intronic
1032022343 7:128415545-128415567 CTAAGCCAGTAGTTCTCTGTGGG + Intergenic
1032573002 7:133021127-133021149 TTAAGGCAGTGGTTCTCAGCTGG - Intronic
1032698947 7:134361936-134361958 TTAGAACAGTGGTCCTCAGCTGG - Intergenic
1033779620 7:144653065-144653087 TTAGGACTCTGGGTCTCTGCTGG + Intronic
1035933933 8:3816326-3816348 TTCTGACAGTGGTTGACTGTGGG - Intronic
1036384130 8:8263111-8263133 ATGGGGCAGCGGTTCTCTGTTGG - Intergenic
1036957697 8:13207656-13207678 TTAGAGTAGTGGTTCTCAGTTGG + Intronic
1037929053 8:22866575-22866597 TTAGTATAGTGGTTATGTGTGGG - Intronic
1038540704 8:28387493-28387515 ATAGGACACTGGTTCTCAGCTGG + Intronic
1038551028 8:28468948-28468970 TTTGAACACTGGTTATCTGTGGG - Intronic
1039129334 8:34244799-34244821 TTAGGACAGTGTTTTTCAATAGG - Intergenic
1040045589 8:42960504-42960526 TTACAATAGTGTTTCTCTGTAGG - Intronic
1041115208 8:54529035-54529057 TCAGGATATTGGTTCTTTGTAGG + Intergenic
1041193649 8:55378533-55378555 TCAGGAAAGTGGTTGCCTGTGGG + Intronic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1042693776 8:71533088-71533110 TTAGAACAGCGGTTGCCTGTGGG + Intronic
1043455431 8:80407557-80407579 TTGGGACAGTGTTTTTCTCTGGG + Intergenic
1043718939 8:83519551-83519573 TTAGGACAGTGTCTCTCAGGAGG + Intergenic
1045979173 8:108163882-108163904 TTAGGACAGTGGTTACATCTGGG - Intergenic
1047311138 8:123693076-123693098 TTACAACAGTGGTTCTCAATTGG - Intronic
1047531192 8:125677774-125677796 TTAGGATAGTGGTTGTCCTTGGG + Intergenic
1047774881 8:128061704-128061726 TCAGTACAGTGGTTTTCTCTGGG + Intergenic
1047905966 8:129473729-129473751 CTAGGCCAGTGGTTCTCAGCTGG + Intergenic
1048077508 8:131088573-131088595 TTAGGTCAGTGTTTCTCAATTGG + Intergenic
1048392793 8:133984147-133984169 TTGGGACAGTGGATTTCTTTGGG - Intergenic
1048717236 8:137283440-137283462 TTAAAACAGTGGTTCTTTCTGGG - Intergenic
1049172391 8:141169620-141169642 TTCGGACAGTGGCTCCCTCTGGG - Intronic
1050167543 9:2781345-2781367 GTAGGACAGTGTTTCGCAGTGGG - Intronic
1051202926 9:14649172-14649194 TGGGTACAGTGGTTCTCAGTTGG - Intronic
1051659863 9:19416010-19416032 TGAGGACAGTGGTTATCTCTGGG + Intronic
1053376585 9:37612229-37612251 CTTGCACAGTGGCTCTCTGTGGG + Intronic
1053401739 9:37830511-37830533 TTTGGATAGTGGTTCCCTCTGGG + Intronic
1053511400 9:38690896-38690918 AGAGCACAGTGGTTCTCTGGGGG - Intergenic
1055530172 9:77176782-77176804 TTAGGTCAGTGGTTCGGTGGAGG + Intergenic
1055639739 9:78310403-78310425 TTAGGAGAATAGTTCACTGTTGG + Intronic
1057270966 9:93651329-93651351 TTTGGCCTGTGGTTTTCTGTTGG + Intronic
1058139644 9:101343684-101343706 TTAGGACAGTGACTGTCTTTAGG + Intergenic
1058562343 9:106243278-106243300 TTAGGACTGTGGTTCTCACTCGG + Intergenic
1058789022 9:108422957-108422979 TTTGGACTGTGGTTGTCTGAGGG + Intergenic
1060651810 9:125334026-125334048 TTAGAACAGTGGTTCTTGATTGG - Intronic
1060905882 9:127305095-127305117 TTAGGACAGTGGTTCTCTTTTGG + Intronic
1061637747 9:131925112-131925134 TTAGGACAGTGGTTCTTAACTGG - Intronic
1062666970 9:137679288-137679310 TTTGGACTGTGGTTGACTGTGGG + Intronic
1186474261 X:9845045-9845067 TTGGGCCACTTGTTCTCTGTGGG + Intronic
1186756502 X:12677252-12677274 GTGGGACAGTGGTTCTCAGCTGG - Intronic
1187007263 X:15245204-15245226 TTAGGACAGTGGTTCACAACTGG + Intronic
1188165472 X:26857564-26857586 TTATGAGAGTTGTTTTCTGTGGG - Intergenic
1189804547 X:44722232-44722254 TTTGGACAGTAGTTCTCTGTAGG - Intergenic
1190282465 X:48940059-48940081 TCAGGAGATTGGTTCTCAGTGGG - Intronic
1190721639 X:53153630-53153652 ATAGGAGAGTGGTTATCTGCAGG + Intergenic
1191591425 X:62889067-62889089 TTTGGATAGGGTTTCTCTGTGGG - Intergenic
1192188963 X:68979086-68979108 TTTGGACAGTGGTTCTCCAGGGG - Intergenic
1192946287 X:75967949-75967971 TTAAGATAGTGGTTCCCTCTGGG + Intergenic
1193158569 X:78202167-78202189 TAAGAACAGTAGTTATCTGTTGG + Intergenic
1194536448 X:95109995-95110017 TAAGGACAGTGGTTACCTCTGGG + Intergenic
1196732551 X:118955530-118955552 TTAGGACAGTGGTTACTTCTTGG - Intergenic
1197259608 X:124304332-124304354 TTAGGAAAGGGGTTATATGTGGG - Intronic
1198675112 X:139123072-139123094 TTAGGGCAGTGGTTCTCAACGGG - Intronic
1198897081 X:141467412-141467434 TTAGGGCAGTGGTTGACAGTGGG - Intergenic
1200226522 X:154420651-154420673 TCAGCACAGTGATTTTCTGTGGG - Exonic