ID: 998557732

View in Genome Browser
Species Human (GRCh38)
Location 5:143141991-143142013
Sequence GGGTTATTACAGGTGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998557729_998557732 -8 Left 998557729 5:143141976-143141998 CCTTTGCAAAGAAAAGGGTTATT 0: 1
1: 0
2: 2
3: 23
4: 250
Right 998557732 5:143141991-143142013 GGGTTATTACAGGTGCTGCAGGG 0: 1
1: 0
2: 2
3: 5
4: 116
998557728_998557732 -7 Left 998557728 5:143141975-143141997 CCCTTTGCAAAGAAAAGGGTTAT 0: 1
1: 2
2: 2
3: 21
4: 298
Right 998557732 5:143141991-143142013 GGGTTATTACAGGTGCTGCAGGG 0: 1
1: 0
2: 2
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998557732 Original CRISPR GGGTTATTACAGGTGCTGCA GGG Intronic
900541797 1:3206617-3206639 GGGTTCCTACAGGTCCTCCATGG - Intronic
900887425 1:5424847-5424869 CTTTTATTACAAGTGCTGCAGGG + Intergenic
902711716 1:18244421-18244443 GGGTTGTTGCAGGTGATGCTGGG + Intronic
903847005 1:26284662-26284684 GGGTGCTTACAGGAGCAGCAGGG - Intronic
907490967 1:54808593-54808615 GTGTTATTCCAGGTGCTGCCGGG + Intronic
910029915 1:82706522-82706544 GCTTTCTTCCAGGTGCTGCAGGG - Intergenic
916946929 1:169738444-169738466 GGCTGATTAGAGGTGCTTCAAGG + Intronic
917292635 1:173487139-173487161 TGGTGATAACAGGTGCTACAGGG + Intronic
918169880 1:181986610-181986632 GGATGACCACAGGTGCTGCAGGG + Intergenic
918290772 1:183105839-183105861 GGGAGATTACAGCTTCTGCAGGG - Intronic
1063910219 10:10821616-10821638 GGCTTACCACAGTTGCTGCAGGG + Intergenic
1067207654 10:44233517-44233539 GAGTTATTGGAGGTCCTGCAGGG + Intergenic
1068310358 10:55266576-55266598 GGGTTTTTACAGGTACAGGATGG - Intronic
1069932380 10:71891464-71891486 GGGTGAGTACAGGGCCTGCAAGG + Intergenic
1071108516 10:82127138-82127160 GGGTGGCTGCAGGTGCTGCAAGG + Intronic
1071134555 10:82438248-82438270 GAGTTATTGGAGGTCCTGCAAGG + Intronic
1076826923 10:132973849-132973871 GGGACAGTCCAGGTGCTGCAGGG - Intergenic
1077185868 11:1235077-1235099 CGGTTCCTGCAGGTGCTGCAAGG - Exonic
1088697735 11:112382828-112382850 GGGTTATTGGAGTTCCTGCAGGG - Intergenic
1088841257 11:113629428-113629450 GGGCTTTTAGAGGAGCTGCAAGG - Intergenic
1100904719 12:99284671-99284693 GGATTATTCCAAGTGCTACATGG - Intronic
1102239322 12:111314082-111314104 GGGATTTTACAGGTGGGGCAGGG - Intronic
1102456925 12:113076964-113076986 GGGTTATCACAGGCCCTGGATGG - Intronic
1102576137 12:113857349-113857371 GGGTTAGGGCAGGTGATGCATGG - Intronic
1105226342 13:18436924-18436946 GTGTTATAATAAGTGCTGCAAGG + Intergenic
1108436944 13:50410235-50410257 TGGTTATTTCAGCTGCTGCTAGG + Intronic
1111535302 13:89595965-89595987 GGGCTATGACAGGTGGTGCTGGG - Intergenic
1114704490 14:24711465-24711487 AGTTTATTCCAGGAGCTGCAGGG - Intergenic
1116593976 14:46816395-46816417 AGGTTATTTCAGGTAGTGCACGG - Intergenic
1119899248 14:78245711-78245733 GGGCTATTGCAGGAGCTGCCTGG + Intronic
1123671858 15:22666696-22666718 TGGTTATTGCTTGTGCTGCAGGG - Intergenic
1124323902 15:28739908-28739930 TGGTTATTGCTTGTGCTGCAGGG - Intergenic
1124527785 15:30473160-30473182 TGGTTATTGCTTGTGCTGCAGGG - Intergenic
1124770873 15:32534542-32534564 TGGTTATTGCTTGTGCTGCAGGG + Intergenic
1124862019 15:33450988-33451010 GGGTTGTTTCAGGTGCTGCAAGG - Intronic
1127578830 15:60318046-60318068 GGGTTTTAACTGGTGCTCCAAGG + Intergenic
1128762120 15:70224236-70224258 GGGTGATCACGGGTGCTGGACGG + Intergenic
1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG + Intronic
1131764888 15:95664926-95664948 GTGTTTTTAAAGGTACTGCAAGG - Intergenic
1134557529 16:15178544-15178566 GGTTTATTACAGGATCGGCAAGG + Intergenic
1134918097 16:18090227-18090249 GGTTTATTACAGGATCGGCAAGG + Intergenic
1135527231 16:23223262-23223284 GTGTTAACACAGGTGTTGCATGG + Intergenic
1137929304 16:52571662-52571684 GCCTTATTACAGGTGATGAAAGG - Intergenic
1142497488 17:314111-314133 CGGTTAGTACAGGTGCTCCTTGG - Intronic
1151379197 17:73713211-73713233 GGGTTTTTACAGGTACCTCAGGG - Intergenic
1152763066 17:82119635-82119657 GGGTGCCTGCAGGTGCTGCAAGG + Intronic
1153780351 18:8490090-8490112 GGGTTAAGCCAGGTTCTGCAGGG + Intergenic
1154001581 18:10486419-10486441 GTGTTATTAGAGGGGCAGCATGG - Intronic
1154527042 18:15302552-15302574 GTGTTATAATAAGTGCTGCAAGG - Intergenic
1158366686 18:56744651-56744673 AGGTGATTTCAGGTGCAGCATGG - Intronic
1158927193 18:62279733-62279755 GGGTATTCACAGGTGATGCACGG - Intronic
1159104038 18:63985343-63985365 GGGTTATTACAGGCAGTGCTGGG + Intronic
1160570691 18:79815784-79815806 GGGTTAGAACAGCTGCTTCAGGG - Intergenic
1166254159 19:41590325-41590347 TGGTAATCACAGGTTCTGCAGGG + Intronic
925894608 2:8461605-8461627 GGCACATTAGAGGTGCTGCAGGG + Intergenic
929724729 2:44413161-44413183 GGCTGATTACAAGTGCTGAATGG + Intronic
930401689 2:50897454-50897476 GGATTATTTTAGGTGCTGAAGGG + Intronic
930545789 2:52765941-52765963 GGGTTATTGGAGATCCTGCAGGG - Intergenic
933237566 2:79882409-79882431 GAGTTATTAGAGTTGCTGCAGGG + Intronic
936050653 2:109221083-109221105 AAGTTATGACACGTGCTGCATGG + Intronic
937290393 2:120778394-120778416 GGGTGATGGCAGGAGCTGCAGGG - Intronic
938526138 2:132134027-132134049 GTGTTATAATAAGTGCTGCAAGG - Intergenic
940213293 2:151278149-151278171 GGTTTTATACAGGTGCTTCATGG - Intronic
946266321 2:218545106-218545128 GGGTTATTTCAGTGGCTGTAGGG + Intronic
946502328 2:220262869-220262891 GGTTTATTACATGAGCTGCTAGG - Intergenic
948046406 2:234949076-234949098 GGATTAATGGAGGTGCTGCATGG - Intergenic
1169421536 20:5464727-5464749 GGGTTATTATAGGTGCAGAATGG - Intergenic
1170713177 20:18810224-18810246 GGGTTATAACAGGCCCTCCAAGG - Intronic
1170953043 20:20953973-20953995 GGGTGTTTGCAGGAGCTGCAAGG - Intergenic
1172764196 20:37342459-37342481 GGGCAAGTACAGGGGCTGCAGGG - Intergenic
1173277938 20:41600843-41600865 GTGTGCCTACAGGTGCTGCATGG + Intronic
1176770393 21:13065953-13065975 GTGTTATAATAAGTGCTGCAAGG + Intergenic
1178501129 21:33126320-33126342 GAGTTATTTCAGATGCTGTATGG - Intergenic
1180517487 22:16159914-16159936 GTGTTATAATAAGTGCTGCAAGG + Intergenic
1182353890 22:29713505-29713527 GTGTAATTAGAGGAGCTGCAGGG - Intergenic
1185321539 22:50202293-50202315 GGGGCATTTCAGGTGCTGGAGGG - Intronic
957268847 3:78003134-78003156 GAGTTATTGGAGTTGCTGCAGGG + Intergenic
965857551 3:173106470-173106492 TGGTTACTACAGGAGCTACAGGG - Intronic
967552850 3:190819372-190819394 GGGTGATTGCAGCTGTTGCATGG - Intergenic
975226644 4:71880326-71880348 GGGTTAATTCAGTTTCTGCAAGG + Intergenic
978204742 4:106068027-106068049 GGATTTTTATAGGTACTGCATGG + Intronic
978619716 4:110626467-110626489 GGGAAACTAGAGGTGCTGCATGG + Intronic
979365777 4:119821746-119821768 GGATTATTCCAGCTGCAGCATGG - Intergenic
980286337 4:130782890-130782912 GGGTTATTACAGGTACTGGATGG - Intergenic
986492445 5:8306763-8306785 GAGTTATTAGAGTTCCTGCAGGG - Intergenic
986814256 5:11390933-11390955 GGGTTATGACAGGTGCAGCTGGG + Intronic
988920700 5:35939057-35939079 GGGTAATTATAGGTGATTCAAGG + Intergenic
990748077 5:58981778-58981800 GGGTTATTAGTGGTCCTGCCTGG + Intronic
992607015 5:78468136-78468158 GGGTCATCATTGGTGCTGCAGGG + Intronic
996220312 5:120924140-120924162 GGGTTATCAGAGTTGCAGCAGGG - Intergenic
997254199 5:132415216-132415238 AGGTTATTTCAGGTGGCGCAGGG + Intronic
998557732 5:143141991-143142013 GGGTTATTACAGGTGCTGCAGGG + Intronic
1000189707 5:158898405-158898427 GGTTTATTACATATGCTTCAGGG - Intronic
1000898348 5:166883541-166883563 GTGTGATTACAGGTGTTGAATGG + Intergenic
1001874874 5:175191300-175191322 GGGCTTTTACAGGTGCTAGAAGG - Intergenic
1003223771 6:4186728-4186750 GGGATATTGCAGGTGCTGAGAGG + Intergenic
1005490075 6:26339859-26339881 GTGTTGATGCAGGTGCTGCATGG - Intergenic
1005822915 6:29612530-29612552 GGGTTAGTACAGGGGCAGGAGGG - Exonic
1008160039 6:48065992-48066014 GGCCTATAACAGGTGCTTCATGG - Intronic
1013646813 6:112151162-112151184 GGGTTATCACAGGGGCTCTAGGG - Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1020854482 7:13400324-13400346 GTGTTGTTTCTGGTGCTGCATGG - Intergenic
1022035094 7:26526554-26526576 GGGTTATGACAACTGCTGCTGGG - Intergenic
1027944049 7:84723024-84723046 GAGTTATTGGAGATGCTGCAGGG - Intergenic
1033870538 7:145749803-145749825 GGGTTTTTACAGGCACTGGATGG + Intergenic
1039685913 8:39801715-39801737 GAGTTATTGGAGATGCTGCAGGG + Intronic
1041791353 8:61699422-61699444 GGGGTACTGCAGGTACTGCAAGG + Intronic
1042809575 8:72809470-72809492 GGGTAATGATAGTTGCTGCAAGG - Intronic
1052852129 9:33384879-33384901 GGGTTCTTACAGGAGCTCCAGGG - Intronic
1053704831 9:40741372-40741394 GTGTTATAATAAGTGCTGCAAGG - Intergenic
1054414910 9:64864980-64865002 GTGTTATAATAAGTGCTGCAAGG - Intergenic
1054824874 9:69563509-69563531 GGGTTAATACACGGGTTGCATGG + Intronic
1054857845 9:69920281-69920303 GGATAATTCCAGGTGCTGCCAGG + Intergenic
1059634765 9:116159969-116159991 TGGTTATTCCAGGTGCAGCCAGG - Intronic
1060173119 9:121477925-121477947 GGGAAAATACAGGTGTTGCAGGG - Intergenic
1060984203 9:127810237-127810259 TGGTTCTGCCAGGTGCTGCAGGG + Intronic
1187215689 X:17274242-17274264 GGGTAACTACAGGAGGTGCATGG - Intergenic
1193039318 X:76987783-76987805 GAGTTATTAGAGATACTGCAGGG - Intergenic
1197992216 X:132330386-132330408 GTGCTAAAACAGGTGCTGCAAGG - Intergenic
1198432420 X:136580867-136580889 GGGGTATTACGTGTGATGCAGGG - Intergenic
1198697393 X:139356046-139356068 GGGTCATGAAAGGTGCTACAAGG - Intergenic
1198867525 X:141140428-141140450 TGGTTACTACAGGTGCTGGTGGG + Intergenic
1199344096 X:146718846-146718868 GAGTTATTATAGTTCCTGCATGG - Intergenic
1200236974 X:154472451-154472473 GGGTTTGTACAGGGGCTGCGGGG + Intronic