ID: 998557766

View in Genome Browser
Species Human (GRCh38)
Location 5:143142346-143142368
Sequence GGAGTTCGAGACTAGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 16, 2: 34, 3: 116, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998557766_998557772 18 Left 998557766 5:143142346-143142368 CCAGGCTGCTAGTCTCGAACTCC 0: 1
1: 16
2: 34
3: 116
4: 230
Right 998557772 5:143142387-143142409 GCCTCGGCCTCCCAAAGTGCTGG 0: 81513
1: 207817
2: 222817
3: 151393
4: 177060
998557766_998557774 19 Left 998557766 5:143142346-143142368 CCAGGCTGCTAGTCTCGAACTCC 0: 1
1: 16
2: 34
3: 116
4: 230
Right 998557774 5:143142388-143142410 CCTCGGCCTCCCAAAGTGCTGGG 0: 120847
1: 270445
2: 211583
3: 123288
4: 170743
998557766_998557768 2 Left 998557766 5:143142346-143142368 CCAGGCTGCTAGTCTCGAACTCC 0: 1
1: 16
2: 34
3: 116
4: 230
Right 998557768 5:143142371-143142393 ACCTTGTGATCCACCTGCCTCGG 0: 2218
1: 11744
2: 31060
3: 53139
4: 65038

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998557766 Original CRISPR GGAGTTCGAGACTAGCAGCC TGG (reversed) Intronic
900274253 1:1813315-1813337 GGAGTTCGAAACCAGCCTCCTGG - Intronic
900637670 1:3673956-3673978 GGAGGTCGAACCCAGCAGCCTGG - Intronic
900889098 1:5436427-5436449 GGAGTTTGAGACTAGCAGCATGG + Intergenic
901521901 1:9791738-9791760 GGAGTTCAAGACCAGCAGCTTGG - Intronic
901759971 1:11464352-11464374 GGAGTTTGAGACCAGCAACATGG - Intergenic
902344326 1:15804877-15804899 GGAGTTCGAGACCAGCAGCCTGG + Intergenic
903519874 1:23938903-23938925 GGAATTCAAGACCACCAGCCTGG + Intergenic
903740070 1:25553643-25553665 GGAGTTCGAGACCAGCTACTCGG + Intronic
903819353 1:26089669-26089691 GGAGTTAGAGACCAGCAACATGG - Intergenic
904687342 1:32270308-32270330 GAAGTTCAAGACAACCAGCCTGG - Intronic
904827517 1:33283498-33283520 GGAGTTCGAGACCAGCAACATGG + Intronic
905140292 1:35838260-35838282 GGAGCTCAAGACCACCAGCCTGG - Intronic
906087690 1:43149864-43149886 GGAGTTTGAGACAAGCAGCTTGG + Intronic
907441942 1:54484315-54484337 GGACTTGGAGACTGGCTGCCTGG + Intergenic
907475812 1:54704650-54704672 GGAGTTCGAGACCACCAGTCTGG - Intronic
908793206 1:67803464-67803486 GGAGTGAGAGAACAGCAGCCTGG + Intronic
911208121 1:95113250-95113272 GGAGGTTGAGACCACCAGCCTGG - Intergenic
912375608 1:109207452-109207474 GGAGTTTGAGACCAGCAACATGG - Intergenic
912783544 1:112576296-112576318 GGAGTTTGGGACTAGCGGCTGGG - Intronic
914000149 1:143687000-143687022 GGAGTTCAAGGCCAGAAGCCTGG + Intergenic
914199403 1:145471440-145471462 GGAGTTTGAGACTATCTTCCTGG - Intergenic
914478518 1:148044573-148044595 GGAGTTTGAGACTATCTTCCTGG - Intergenic
914503664 1:148269721-148269743 GGAGTTCAAGGCCAGAAGCCTGG - Intergenic
915209890 1:154300662-154300684 GGAGTTCAAGACCAGCCCCCTGG - Intergenic
916029244 1:160862156-160862178 GGAGGGCGAGGCCAGCAGCCAGG - Intronic
916187333 1:162145912-162145934 GGGGTCCTAGACTAGAAGCCAGG + Intronic
916887024 1:169079504-169079526 GGAGTTGGAGACCAGCCGCCTGG + Intergenic
917338963 1:173954751-173954773 CGAGTTTGAGACCACCAGCCTGG + Intronic
918344173 1:183591690-183591712 GGAGTTCGAGACCATCAGCCTGG - Intronic
919740783 1:200980456-200980478 GGAGTTTGAGACTACCTGCGTGG - Intronic
919874757 1:201856175-201856197 GGAGTTAGAGACTACTAGCCTGG - Intronic
920343575 1:205291640-205291662 GGAGTTCGAGACCAGCCTCGAGG + Intergenic
920690392 1:208142152-208142174 GGAGCTAGAGAGAAGCAGCCGGG - Intronic
921085811 1:211791536-211791558 GGAGTTTGAGACCAGCAGCCTGG + Intronic
921705305 1:218315660-218315682 GGAGTTCGAGGAGACCAGCCTGG - Intronic
923609306 1:235475895-235475917 TGAGTTTGAGACGACCAGCCTGG - Intronic
923798885 1:237187347-237187369 GGAGATCGAGACAACCATCCTGG - Intronic
924529303 1:244879988-244880010 GGAGTTTGAGACCAGCAGCAAGG - Intergenic
924856751 1:247881810-247881832 GGAGTTCAAGACCACTAGCCTGG - Intergenic
1063698872 10:8365108-8365130 GGAGTTCAAGACCACAAGCCTGG + Intergenic
1064019009 10:11794399-11794421 GGAGTTCGAGACTCCTGGCCTGG + Intergenic
1064530510 10:16304190-16304212 GGAGTTCGAGGAGACCAGCCTGG + Intergenic
1065017395 10:21474824-21474846 GGAGTTTGAGACCAGCAACATGG - Intergenic
1067104664 10:43358118-43358140 GGAGTTCAAGACCAGCAGCCTGG + Intergenic
1068450033 10:57174303-57174325 GGAGTTCAAGGCCAGCAGCCTGG - Intergenic
1070021475 10:72590600-72590622 GGAGTTCGAGACCAGCCTCCTGG + Intronic
1070100392 10:73380478-73380500 GGAGTTAGAGACCAGCACCTGGG - Intronic
1070157290 10:73843270-73843292 GGAGTTCGAGACCACCAGCCTGG - Intronic
1072129298 10:92477360-92477382 GGAGTTCGAGACCAGCCTCCTGG - Intronic
1072233375 10:93431953-93431975 AGAGTTCAAGACCACCAGCCTGG - Intronic
1072752359 10:97991195-97991217 GGAGTTTGAGGCCAGCAGCCTGG + Intronic
1072966563 10:99978779-99978801 GGAGTTCAAGACCACCAGCCTGG - Intronic
1073197036 10:101700109-101700131 GGAGTTCAAGACCAGCCTCCAGG + Intergenic
1073355632 10:102851696-102851718 GGAGTTCAATATCAGCAGCCTGG - Intergenic
1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG + Intronic
1074619325 10:115102651-115102673 GGAGTTAGAGACCACCAGCCTGG - Intronic
1074846172 10:117400074-117400096 GGAGTTAGAGACCAGTATCCTGG + Intergenic
1075011317 10:118872690-118872712 GGAGTTCAAGACCAGTAGCCTGG - Intergenic
1075156610 10:119982502-119982524 GGAGTTCGAGACTTGACGTCAGG - Intergenic
1075613533 10:123874067-123874089 GGAGTTTGAGACAACCACCCTGG - Intronic
1077757776 11:5053939-5053961 GGAGTTGGAGACTAGCAACATGG - Intergenic
1078133415 11:8632665-8632687 GGATTTCAAGACCAGCAGCCTGG - Intronic
1078704128 11:13722681-13722703 GGAGTTCCAGACCAGCAGCTTGG - Intronic
1079327264 11:19504985-19505007 GGAGTTCGAGACTGAAACCCAGG + Intronic
1080677951 11:34445281-34445303 GGAGTTTGAGATCATCAGCCTGG + Intronic
1083278841 11:61613046-61613068 GGAGTTCAAGACCACCAGCCTGG - Intergenic
1084488285 11:69463792-69463814 GGGGTTCCAGACTAGGAGCCTGG + Intergenic
1085207170 11:74742500-74742522 GGAGTTTGAGACGAGCAGGCTGG + Intergenic
1089063578 11:115645637-115645659 GGAGTTCTGGACTTGCTGCCTGG + Intergenic
1089379781 11:118020054-118020076 GGAGTTCAAGACGACCAGCCTGG + Intergenic
1090212011 11:124927573-124927595 GGAGTTCAAGACCAGCCACCTGG - Intronic
1093728922 12:22545464-22545486 GGAGTTCGAGACCAGCCTCATGG + Intergenic
1094545606 12:31401829-31401851 GGAGTTTGAGACGACCAGCCTGG - Intronic
1094554751 12:31487489-31487511 GGAGTTCAAGACCACCAGCCTGG + Intronic
1094645892 12:32324120-32324142 GGAGTTCGAGACCAGCCGCCAGG + Intronic
1095096413 12:38151812-38151834 GGAGTTCCTGACTTGCACCCAGG + Intergenic
1095837799 12:46657139-46657161 GGAGTCCTGGACTAGCAGGCAGG + Intergenic
1096157947 12:49351687-49351709 GGAGTTCGAGACCAGCAGCCTGG + Exonic
1096162749 12:49393886-49393908 GGAGTTCAACACCACCAGCCTGG - Intronic
1096265969 12:50122920-50122942 GGAGTTCGAGTTAACCAGCCTGG - Intergenic
1097554223 12:61116925-61116947 GGAGTTAGAGACCATCAGCCTGG + Intergenic
1098235197 12:68411465-68411487 GGAGTTTGAGACCAGCAACATGG + Intergenic
1098591294 12:72216229-72216251 AGACTTCTAGGCTAGCAGCCTGG + Intronic
1098944842 12:76578358-76578380 GGAGTTCAAGAGCAGCAGCCTGG + Intergenic
1100694478 12:97077039-97077061 AGAGTTGGAGACCAGCAGCCTGG + Intergenic
1100861632 12:98812781-98812803 GGCGTTTGAGACCACCAGCCTGG - Intronic
1101990517 12:109480439-109480461 GGAGTTTGAGACCACCAACCTGG + Intronic
1102466982 12:113135737-113135759 GGAGCTCCAGACAAGCAGGCTGG + Intronic
1102480304 12:113218649-113218671 GGAGTTTGAGCCTAGGAGCCTGG - Intronic
1103105532 12:118221431-118221453 GGAGTTTGAGACCAGCCACCTGG - Intronic
1103256939 12:119549750-119549772 GGAGTTCGAGACCACCAGCCTGG + Intergenic
1103693459 12:122794875-122794897 GGAGTTCAAGACCAGCAGCCTGG - Intronic
1104705080 12:130938524-130938546 GGAGTGCAAGACCAGCAGCCTGG - Intergenic
1106498224 13:30302079-30302101 GGAGTTTGAGACAAGTTGCCTGG - Intronic
1106664247 13:31835179-31835201 GGAGTTCAAGATCATCAGCCTGG - Intergenic
1108225008 13:48280288-48280310 GGAGTTTGAGACCACCAGCCTGG - Intergenic
1108886431 13:55189556-55189578 GGAGTTTGAGTCCAGCAGCTAGG - Intergenic
1110976035 13:81835521-81835543 GGGGTTCGAGACCAGCAGCCTGG - Intergenic
1111015523 13:82376041-82376063 GGAGTTCATGACCAGCAGCCTGG + Intergenic
1112323792 13:98430030-98430052 GGAGTTTGAGACCACCAGCCTGG + Intronic
1115182211 14:30642295-30642317 GGAGTTTGAGACTACTAGCCTGG - Intronic
1115663271 14:35518672-35518694 GGAGTTTGAGACCAGCCGCCTGG - Intergenic
1116347736 14:43816728-43816750 GGAGTTCGAGACCACCAGCCTGG + Intergenic
1116421850 14:44742422-44742444 GGAGTTCAAGACCAGCAGCATGG + Intergenic
1117381820 14:55172070-55172092 GGAGTTCAGGACTAGTAGCCTGG - Intronic
1118191974 14:63589096-63589118 GGAGTTTGAGACGACTAGCCTGG - Intergenic
1118305355 14:64650722-64650744 GGAGTTGGAGACCAGAGGCCAGG - Intergenic
1119095002 14:71821831-71821853 GGAGTTTGAGACCAGCAACATGG - Intergenic
1120421549 14:84292487-84292509 GGAGTTCAAGACGACCAGCCTGG - Intergenic
1120424336 14:84328359-84328381 GGAGTTCGAGACCACCAGCCTGG + Intergenic
1121538185 14:94705792-94705814 GGAGTTCGAGACGACCAGCCTGG - Intergenic
1122072621 14:99214344-99214366 GGAGTTTGAGAACAACAGCCTGG + Intronic
1124116776 15:26851014-26851036 GGAGTTCAAGACGACCAGCCTGG - Intronic
1124633686 15:31351801-31351823 GGAGTTCAAGACTACTGGCCTGG + Intronic
1127523091 15:59762604-59762626 GGAGTTCAAGACCACTAGCCTGG - Intergenic
1128233857 15:66053927-66053949 GGAGTTCAAGACCAACAGCCTGG - Intronic
1128404747 15:67324151-67324173 GGAGTTCGAGACCAGCAGCCTGG - Intronic
1128912399 15:71527920-71527942 GGAGTTTGAGACCACCAGCCTGG - Intronic
1129057167 15:72828660-72828682 GGAGTTTGAGACCAGCAGCCTGG + Intergenic
1129339964 15:74879267-74879289 GGAGTTTGAGACCAGCCTCCTGG - Intergenic
1131269475 15:90938001-90938023 GGAGTTCAAGACCAGCCACCTGG - Intronic
1133194889 16:4162178-4162200 GGAGTTCAAGACCAGCATCCTGG + Intergenic
1133378535 16:5310190-5310212 GGAGTTTGAGACCAGCTGCCTGG + Intergenic
1133779557 16:8927109-8927131 GGAGTGCGAGACCAGCAGCCTGG + Intronic
1133879996 16:9772580-9772602 GGAGTTTGAGATCATCAGCCTGG - Intronic
1133952123 16:10404747-10404769 GGAGTTCGAGGCCAGGAGCCTGG - Intronic
1136392016 16:29971430-29971452 GGAGCCCAAGACCAGCAGCCTGG - Exonic
1136418742 16:30118930-30118952 GGAGTTTGAGACCACCAGCCTGG + Intronic
1136581303 16:31152757-31152779 GGAGTTCAAGACCAGCAGCCTGG + Intergenic
1136763102 16:32751111-32751133 GGAGTTTGAGATGATCAGCCTGG + Intergenic
1136804998 16:33119275-33119297 GGAGTTTGAGATGATCAGCCTGG - Intergenic
1138568303 16:57850191-57850213 GAAGTTCCAGACCACCAGCCTGG + Intronic
1138834021 16:60411384-60411406 GGAGTGGGAGACCAGGAGCCTGG + Intergenic
1140178002 16:72684308-72684330 GGAGTTAGAGACTAGCAACATGG + Intergenic
1140452505 16:75082086-75082108 GGAGTTCAAGACCGCCAGCCTGG - Intronic
1140653060 16:77109268-77109290 GGAGTTAGAGACTAGCAGCCTGG + Intergenic
1141201152 16:81898976-81898998 GGAGTTTGAGACCAGCAGCCTGG + Intronic
1141255772 16:82401093-82401115 GGAGCTTGAGACAACCAGCCTGG - Intergenic
1141310655 16:82910636-82910658 GTGGTTTGAGACTAGGAGCCTGG - Intronic
1203065253 16_KI270728v1_random:1011433-1011455 GGAGTTTGAGATGATCAGCCTGG + Intergenic
1142505351 17:360025-360047 GGAGTTAGAGATCAGAAGCCAGG + Intronic
1142964508 17:3572309-3572331 GGAGCTGGATACTGGCAGCCAGG - Intronic
1143127194 17:4650266-4650288 AGAGTTCAAGACCACCAGCCTGG - Intergenic
1143209197 17:5171140-5171162 GGAGTTTGAGACCAGCTGCTTGG + Intronic
1143337159 17:6180001-6180023 GGAGATCGAGACCACCATCCTGG + Intergenic
1143381974 17:6502241-6502263 GGAGTTCAAGAGTAGTAGCCCGG + Intronic
1143553923 17:7649278-7649300 GGAGTTCGAGACCAGAGGTCAGG - Intronic
1143645134 17:8225064-8225086 GGAGTTCCAGACCAGCAGCCTGG - Intergenic
1143716225 17:8771626-8771648 GGAGTTTGAGACCACCAGCCTGG - Intergenic
1143758812 17:9086294-9086316 GGAGTTCGAGTCCAGCAGTTTGG + Intronic
1143798396 17:9357172-9357194 GGAGTTTGAGACCGCCAGCCTGG - Intronic
1143965047 17:10751050-10751072 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1144783714 17:17820386-17820408 GGAGGTGGAGACAAGCTGCCTGG + Exonic
1145765161 17:27453984-27454006 AGAGTTTGAGACCAGCAGCCTGG + Intergenic
1146062754 17:29615657-29615679 GGAGTTCGGGACTAAAAGCCGGG + Exonic
1146233581 17:31135781-31135803 GGAGTTCAAGACTAGCCCCTGGG - Intronic
1147792844 17:43024367-43024389 GGAGATCGAGACTATCATCCTGG - Intronic
1147922917 17:43929471-43929493 GGAGTTCGAGATCAGCAGCCTGG - Intergenic
1148044498 17:44734482-44734504 AAAGTTCCAGAATAGCAGCCTGG - Intronic
1148634675 17:49139430-49139452 GGAGTTTGAGACCAGCAACATGG - Intronic
1148655550 17:49280627-49280649 GAGGTTCAAGACCAGCAGCCTGG + Intergenic
1148655659 17:49281472-49281494 GGAGTTCGAGACCAGCAGCCTGG - Intergenic
1150016227 17:61560170-61560192 GGAGTTCAAGACCAGCGGCGTGG - Intergenic
1150342846 17:64382828-64382850 GGAGTTCGAGACCAGCCTCCTGG + Intronic
1150717754 17:67586374-67586396 GGAGTTTGAGAAGACCAGCCTGG + Intronic
1150918195 17:69457500-69457522 GGACTTGCAGACCAGCAGCCTGG + Intronic
1150961216 17:69914452-69914474 GGAGTTCAAGACGACCAACCTGG + Intergenic
1151664762 17:75539448-75539470 GGAGCTGGAGACGACCAGCCTGG - Intronic
1152774091 17:82189058-82189080 GGAGTTGAAGACCACCAGCCTGG + Intronic
1154125350 18:11688077-11688099 GGAGTTCGAGACCAGCAGCCTGG + Intergenic
1154211129 18:12379317-12379339 GGAGTTTGAGACCAGCAAGCAGG + Intergenic
1155291293 18:24345022-24345044 GGGATTCGAGACCACCAGCCTGG - Intronic
1155434848 18:25801615-25801637 GGAAAGCAAGACTAGCAGCCAGG + Intergenic
1160714530 19:570365-570387 GGAGTTCAGGACTGGCAGCCTGG - Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1161690529 19:5730706-5730728 GGAGTTCAATACCACCAGCCTGG + Intronic
1162338603 19:10077634-10077656 GGAATTCAAGACCAGCAGCTTGG - Intergenic
1162647004 19:12057218-12057240 GGAGTTCGAGACCAGCAGCCTGG + Intergenic
1163004060 19:14386480-14386502 GGAGATCAAGACTACCATCCTGG + Intronic
1163051490 19:14688063-14688085 GGAGTTCCAGATGACCAGCCTGG - Intronic
1163086990 19:14988806-14988828 GGAGTAGGAGACGACCAGCCTGG + Intronic
1163524161 19:17810282-17810304 GGAGTTCGAGACCAGCTTCTTGG + Intronic
1163798530 19:19350992-19351014 GGAGTTCAAGACCACCAGCCTGG + Intronic
1164493560 19:28736624-28736646 GGGTTTAGAGTCTAGCAGCCAGG + Intergenic
1165238737 19:34446083-34446105 GGAGTTTGAGACTTGAAACCAGG - Intronic
1165296200 19:34927994-34928016 GGAGTTCGAGACCACCAACATGG + Intronic
1165306541 19:35006119-35006141 GGAGTTCGAGACCAGCAACGTGG + Intronic
1165559680 19:36668152-36668174 GGAGTTCGAGACCACCAGCCTGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1165731029 19:38144840-38144862 GGAGGTCTAGACTGGCTGCCTGG + Intronic
1166498244 19:43321303-43321325 GGAGTTCAAGACCAGCAACATGG - Intergenic
1166797430 19:45435662-45435684 GCAGTTTGAGATCAGCAGCCTGG - Intronic
1167884466 19:52488883-52488905 TGAGTTGGAGACTACCTGCCTGG + Intronic
1168214204 19:54913258-54913280 GGAGTTCGAGACCAGCCAACAGG - Intronic
926661675 2:15473618-15473640 GGAGCTCTGGACTAGAAGCCGGG - Intronic
927721152 2:25383425-25383447 GGAGTTCAAGACCAGCAGGCTGG - Intronic
928874252 2:36018432-36018454 GAAGCTCGAGACCAGCAGCCTGG + Intergenic
929130555 2:38565497-38565519 GGAGTTCAAGACCACCAGCCTGG + Intronic
929481353 2:42311358-42311380 GGAGTTCGAGACCAGCAACATGG + Intronic
930594116 2:53365029-53365051 GGAGTTCAAGACCAGAAACCAGG + Intergenic
930649674 2:53952227-53952249 GGAGTTCGAGACCACCAGCCTGG + Intronic
930667403 2:54113450-54113472 GGAGTTAGAGATGACCAGCCTGG - Intronic
930761856 2:55047118-55047140 GGAGTTCAAGACCACCAGCCTGG + Intronic
930810695 2:55537168-55537190 GGAATTCGAGACCAGCAACATGG + Intronic
933884479 2:86705359-86705381 GGAGATCAAGACCACCAGCCTGG - Intronic
935230172 2:101089141-101089163 GGAGTTCAAGACCACCACCCTGG + Intronic
937030465 2:118735092-118735114 GGAGTTCAAGACTGGTGGCCTGG - Intergenic
938189008 2:129257458-129257480 GGTGTTCCAGCCTAGCAGACGGG - Intergenic
941314960 2:163980917-163980939 GGAGTTTAAGACCACCAGCCTGG - Intergenic
941810094 2:169747153-169747175 GGAGTTCAAGACTAGCACCTGGG + Intronic
942020520 2:171863315-171863337 GGAGTTCGAGACAACAAGCCTGG + Intronic
942438730 2:176009164-176009186 GGAGTTCGAGACCAGCAACATGG + Intergenic
943678818 2:190746072-190746094 GGAGTTCAAGACCAGCAACCTGG + Intergenic
944788243 2:203095961-203095983 GGAGTTCCAGACCGGCAGCCTGG - Intronic
945288144 2:208102925-208102947 GGAGTTCGAGACCAGCAGCCTGG + Intergenic
945294771 2:208159796-208159818 GGAGATCAACACTACCAGCCTGG - Intergenic
946403614 2:219481507-219481529 GGAGTTTGGGAGTAGCAGGCAGG - Intronic
948145299 2:235703881-235703903 GGAGTTCAAGACTAGCCTGCAGG - Intronic
1169128070 20:3145351-3145373 GGAGTTCCAGACCAGCAACATGG - Intronic
1171976764 20:31599975-31599997 GGAGTTGGAGACCACCAGCCTGG + Intergenic
1172141600 20:32726179-32726201 GGAGTTCAAGACCACCAGCCTGG + Intronic
1172241873 20:33418448-33418470 GGAGTTCAAGACCAGCAACATGG - Intronic
1172416397 20:34772117-34772139 GGAGTTCAAGACTAGCGACATGG + Intronic
1174202339 20:48815798-48815820 GGGGTTTGAGACCACCAGCCTGG + Intronic
1174237461 20:49105565-49105587 GGAGTTCAAGACCACCAGCCTGG - Intergenic
1174969124 20:55254346-55254368 GGAGTTAGAGATGGGCAGCCTGG - Intergenic
1174969141 20:55254418-55254440 GGAGTTAGAGATGGGCAGCCTGG - Intergenic
1174969148 20:55254442-55254464 GGAGTTAGAGATGGGCAGCCTGG - Intergenic
1175039119 20:56028969-56028991 GGAGTTTGAGACTACTAGCCTGG - Intergenic
1176724170 21:10416027-10416049 GGAGTTCGAGACTAGTCTGCTGG + Intergenic
1178847791 21:36187805-36187827 GGAGTTCAAGACCAGCAACATGG - Intronic
1178921586 21:36742462-36742484 GGAGTTCGAGACCAGCTCCTGGG - Intronic
1179120791 21:38543944-38543966 GAAGTTTGAGACGACCAGCCTGG - Intronic
1179454381 21:41488845-41488867 GGAGTTTGAGACCACAAGCCTGG - Intronic
1180632427 22:17238835-17238857 GGAGTTCGAGACCAGTAACATGG - Intergenic
1181472864 22:23151673-23151695 GGAGTTTGAGACTACTAGCCTGG + Intronic
1181693450 22:24580127-24580149 GGAGCTCGAGACCAGCAACATGG + Intronic
1182607568 22:31518194-31518216 GGAGTTCAAGACCACCAGCCTGG - Intronic
1184675765 22:46042283-46042305 GGAGATCGAGACCACCACCCTGG + Intergenic
1184914949 22:47562992-47563014 GGAGTTCCAGACCACCAGGCTGG - Intergenic
1185246642 22:49776401-49776423 GGAGTTGGAGCCTTGTAGCCTGG - Intronic
949429503 3:3959469-3959491 GGAGTTCGAGACCCTCAGCCTGG - Intronic
949710693 3:6867053-6867075 GGAGTTCCAGAATATCAGCAGGG - Intronic
950045379 3:9946042-9946064 GGAGTTCGAGATCAGCCTCCTGG - Exonic
950221390 3:11199145-11199167 GGAGTTCAAGACCAGCCTCCAGG - Intronic
950316884 3:12009892-12009914 GGAGTTCAAGACCAGCAACACGG + Intronic
950392256 3:12705877-12705899 GGAGTTCGAGACCAGCAACATGG + Intergenic
950807391 3:15618171-15618193 GGAGTTTGAGACCACCAGCCTGG - Intronic
951009704 3:17662097-17662119 GGAGTTAGAGACCACCAACCTGG - Intronic
952985241 3:38773258-38773280 GGAGTTTGAGGCCAACAGCCTGG + Intronic
953166340 3:40468347-40468369 GGAGTTCAAGACTGCCAGGCAGG - Intergenic
953526591 3:43695091-43695113 GGAGGTCAAGACCAGCTGCCTGG - Intronic
953739968 3:45529358-45529380 GGAGTTCGAGACCAGCCGTCAGG + Intronic
954253241 3:49384852-49384874 GGAGTTCGAAACCAGCAGCCTGG + Intronic
954547221 3:51447198-51447220 GGAGTTCGAGACCAGCCTCCTGG + Intronic
954594337 3:51812534-51812556 GGAGTTTGAGACCACCAGCCTGG + Intergenic
959008624 3:101048703-101048725 GGAGTTCAAGAAGAGCAGCCTGG + Intergenic
959546448 3:107602505-107602527 GGAGTTTGAGATCATCAGCCTGG + Intronic
959777558 3:110186582-110186604 GGAGTTCGAGACCAGCCTACTGG - Intergenic
960893660 3:122478510-122478532 GGAGTTCAAGACCACCAGCCTGG + Intronic
961054340 3:123775237-123775259 GCAGTTCGAGACCACCAGCCTGG - Intronic
962715365 3:138121382-138121404 GGAGTTCGAGACCACCAGCCTGG - Intergenic
963563037 3:146891357-146891379 GAAGTTAGAGGCCAGCAGCCTGG - Intergenic
963838586 3:150081776-150081798 GGAGATCGAGACCATTAGCCGGG + Intergenic
965459396 3:168943077-168943099 GGAGATCGAGACTATTAACCCGG - Intergenic
965557054 3:170029316-170029338 GGAGTTCAAGACCAGCAACATGG - Intergenic
965647732 3:170901646-170901668 GGAGTTCGAGACCACCAGGGAGG - Intronic
965823524 3:172708563-172708585 GGAGTTCGAGACCAGCAGCCTGG - Intronic
965978541 3:174657232-174657254 GGAGTTCGAGACCAGCAACATGG - Intronic
966212531 3:177468254-177468276 GGAGTTCAAGAAGACCAGCCTGG - Intergenic
966219920 3:177541206-177541228 GGGGTTTGAGACCACCAGCCTGG - Intergenic
966822068 3:183932956-183932978 GGAGTTCAAGACCACCAGCCTGG + Intronic
967463469 3:189775007-189775029 GGAGTTTGAGACCAGCAGCCTGG + Intronic
968029800 3:195474032-195474054 GGAGTTTGAGACCAGCTGCTCGG - Intergenic
971874969 4:32296847-32296869 GGAGTTCGAGAACAGCCACCTGG + Intergenic
972408698 4:38770071-38770093 GGAGCTAGAGTCTAGCAGCTTGG - Intergenic
972944644 4:44239316-44239338 GGAATTTGAGACTAGTAGTCTGG - Intronic
973964816 4:56151204-56151226 GGAGTTCGAGACCAGCAGCCTGG - Intergenic
975109248 4:70605714-70605736 GGAGTTCTAGACCAGCAGCCTGG + Intronic
975874894 4:78824991-78825013 GGAATTCGAGACCAGCAGCCTGG + Intronic
976685777 4:87813032-87813054 GGAGTTCAAGACCAGCCGCCTGG - Intergenic
977261960 4:94807892-94807914 GGAGTCTGAGACCACCAGCCTGG - Intronic
978154733 4:105475566-105475588 GGAGTTTGAGACCAGCAGTCTGG + Intergenic
978441845 4:108741504-108741526 GGAGTTCAAGACCAGCCTCCTGG + Intergenic
979534442 4:121803738-121803760 GGAGTTCAAGACTAGCCTGCTGG - Intronic
983058131 4:163123587-163123609 GGAGTTCAAGACCACCAACCTGG - Intronic
983606446 4:169591359-169591381 GGAGTTCAAGACCACTAGCCTGG - Intronic
984794395 4:183644888-183644910 GGAGTTCGGGACCAGCAGCCTGG + Intronic
985087894 4:186332687-186332709 GGAGTTTGAAACGACCAGCCTGG - Intergenic
987089829 5:14500685-14500707 GGAGTTAGAGACCAGCAACATGG + Intronic
987107149 5:14650874-14650896 GGAGTTCAAGACCAGCAGCCTGG + Intergenic
987595949 5:19999391-19999413 GGAGTTTGAGACCACCAGCCTGG + Intronic
987718906 5:21609674-21609696 GGAGTTCGAGACCAGCAACATGG + Intergenic
988517804 5:31919804-31919826 GGAGTTTGAGACCAGCCACCTGG + Intronic
989093536 5:37759229-37759251 GGAGTTCGAGACCAGCAGCCTGG + Intergenic
989594426 5:43142900-43142922 GGAGTTCGAGACTAGTAGCCTGG - Intronic
991565289 5:67998410-67998432 GGAGTTCGAGACCAGCCGCCTGG + Intergenic
991901501 5:71465075-71465097 GAAGTTCAAGACCACCAGCCTGG - Intronic
992441633 5:76802300-76802322 GGAGTTCAAGACCAGCAGCCTGG + Intergenic
993892832 5:93494423-93494445 GCAGTTCAAGACCACCAGCCTGG + Intergenic
994366345 5:98921941-98921963 GGAGTTCAAGACCACCAGCCTGG + Intronic
994906419 5:105845438-105845460 GGAGCTAAAGACTAGGAGCCAGG + Intergenic
997122945 5:131195055-131195077 GGAGTTTGAGACCAGCCCCCTGG + Intronic
998557766 5:143142346-143142368 GGAGTTCGAGACTAGCAGCCTGG - Intronic
998905963 5:146905448-146905470 GGAGTTCAAGACCACCAGCCTGG - Intronic
999186328 5:149712799-149712821 GGAGTTCGAGACCACCATCCTGG - Intergenic
1001648697 5:173300417-173300439 TGAGTTCTAGACTAACAGCTGGG + Intergenic
1002362021 5:178679814-178679836 AGAGTTCGAGACCACCAGCCTGG + Intergenic
1002952268 6:1825804-1825826 GGAGTTTCAGACCAGCCGCCTGG + Intronic
1004417600 6:15438820-15438842 GGAGTAAGAGACCACCAGCCTGG + Intronic
1004915242 6:20325918-20325940 GGAGTTTGAGACGACCAGCTGGG + Intergenic
1004915492 6:20328247-20328269 GGAGTTTGAAACCACCAGCCCGG - Intergenic
1004951049 6:20672559-20672581 GGAGTTCGAGACCAGCCACCTGG - Intronic
1006690115 6:35876428-35876450 GGAGTTCAAGAAGACCAGCCTGG + Intronic
1008687506 6:53941847-53941869 GGATTTCGAGACCAGAAGCAGGG - Intronic
1008704047 6:54136840-54136862 GGAGTTCCACACTAGGAGGCTGG + Exonic
1008911943 6:56743945-56743967 GGAGTTCGAGACCACCTGCATGG + Intronic
1009356648 6:62756253-62756275 GGAGTTTGAGAAGACCAGCCAGG + Intergenic
1009994217 6:70880873-70880895 GGAGTTTGAGACCACCAGCCTGG - Intronic
1010197110 6:73251031-73251053 GGAGTTTGACGATAGCAGCCTGG - Intronic
1010425327 6:75723018-75723040 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1011293967 6:85807502-85807524 GGAGTTCAAGACCAGCAGCCTGG - Intergenic
1011520972 6:88205734-88205756 GGAGATCGAGAGTAGCAGGATGG + Intergenic
1011818318 6:91220139-91220161 AGAGTTCAAGACCACCAGCCTGG + Intergenic
1011991145 6:93519170-93519192 GGAGTTCGAGACCACCAGCCTGG - Intergenic
1012333658 6:98026656-98026678 GGAGTTTGAGACTGGCAACAGGG - Intergenic
1012460499 6:99455233-99455255 GGAGTTTGAGACCACCAGCCTGG + Intronic
1012547469 6:100435958-100435980 GGAGTTCATGACTGGCAGCAAGG - Intronic
1013150068 6:107437313-107437335 GGAGTCTAAGACCAGCAGCCTGG + Intronic
1013238764 6:108223707-108223729 GGAGTTTGAGACCACCAGCCTGG - Intronic
1013996744 6:116317556-116317578 AGATTTAGAGACTAGCAGCATGG - Intronic
1014592621 6:123292367-123292389 GGAGCCAGAGACTAGGAGCCAGG + Intronic
1016685073 6:146871592-146871614 GGAGTTTGAGACCAGCAACATGG - Intergenic
1017913044 6:158811652-158811674 GGAATTTGAGACTAGCCGCCTGG + Intronic
1019809062 7:3150809-3150831 GGAGTTTGAGACCAGAAGACTGG - Intronic
1019857332 7:3622269-3622291 GGAGTTCGACACCACCAGCCTGG + Intronic
1020258713 7:6518023-6518045 GGAGTTCAAGACCAGCAACATGG + Intronic
1020972739 7:14966508-14966530 GGAGTTCGAGACCAGCAGCCTGG - Intronic
1021182282 7:17520539-17520561 GAAGTTCCAAACTAGCAGCATGG - Intergenic
1021649522 7:22820126-22820148 GAAGTTCAAGACCACCAGCCTGG + Intronic
1022457044 7:30566593-30566615 GGAGTTTGAGACCAGCCTCCTGG - Intergenic
1022788122 7:33659529-33659551 GGAGTTCAAGACCAGCTGCTTGG - Intergenic
1023116550 7:36868554-36868576 GGAGTTCGAGACCAGCAGCCTGG - Intronic
1026033440 7:66814958-66814980 GGAGTTGGAGACCACCAGCCTGG + Intergenic
1026156844 7:67833833-67833855 GGAGTTCAAGAAGACCAGCCTGG - Intergenic
1026272226 7:68846401-68846423 GGAGTTTGAAACCACCAGCCTGG - Intergenic
1026654840 7:72247782-72247804 GGAGTTGGAGATGACCAGCCTGG + Intronic
1026662380 7:72313602-72313624 GGAGTTTGAGACCACCAGCCTGG - Intronic
1026809773 7:73453776-73453798 GGAGTTCAAGACCAGCAACATGG + Intronic
1027002509 7:74663495-74663517 GGAGTTGGAGACCACCAGCCTGG - Intronic
1027630183 7:80594447-80594469 GGAGTTTGAGACCAGCCCCCTGG - Intronic
1028177685 7:87676492-87676514 GGAGTTCAAGACAACCAGCCTGG + Intronic
1029985271 7:104917168-104917190 GGAGTTCAAGACCAGGAGCCTGG + Intergenic
1030285022 7:107817128-107817150 GGAGTTCTAGACTAGCAGCCTGG - Intergenic
1032100134 7:128968930-128968952 GGAGCTTGAGACTACCAGCCTGG - Intronic
1032326338 7:130932381-130932403 GGAGTTTGAGACCAGCAACATGG + Intergenic
1032340250 7:131065322-131065344 GGAGTTCGAGACCAGCCACATGG + Intergenic
1032683365 7:134208073-134208095 TGAGTGCGGGAATAGCAGCCTGG + Intronic
1032825831 7:135566945-135566967 GGAGTTCGAGACCAGCCACCTGG - Intronic
1036087476 8:5628002-5628024 GAAGTTTGAGACCAGCAGCCTGG - Intergenic
1037513770 8:19610010-19610032 GGAGTTCAAGACGATCAGCCTGG + Intronic
1037778387 8:21850582-21850604 AGAGTTTGAGACCAGCGGCCGGG + Intergenic
1039040260 8:33401190-33401212 GGAGTTTGAGACCAGCCGCCTGG - Intronic
1039936985 8:42053219-42053241 GGAGTTCGAGACCAGCGGCCTGG - Intergenic
1043854457 8:85248551-85248573 GGAGTTCCAGACTAGCCTGCAGG + Intronic
1044804881 8:95995416-95995438 GGAGTTCGAGACCAGCAGCCTGG - Intergenic
1045389909 8:101705015-101705037 GGAGTTCGAGACGACCAGCCTGG + Intronic
1046176923 8:110588382-110588404 GGAGATCGAGACCATCACCCTGG - Intergenic
1047472840 8:125196088-125196110 GGAGGTCGAGACCAGGAGCCTGG - Intronic
1049227335 8:141461854-141461876 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1050512595 9:6411989-6412011 GGAGATCGAGACTATTAGCCGGG + Intergenic
1050570575 9:6934057-6934079 GGAGTTCAAGAAGACCAGCCTGG - Intronic
1051616076 9:19008182-19008204 GGAGTTCAAGATCACCAGCCTGG - Intronic
1051793089 9:20830882-20830904 GGAGTTCAAGACAACCAGCCTGG - Intronic
1055023186 9:71691897-71691919 GGAGTTCAAGACCAGCCCCCTGG + Intronic
1055329752 9:75171534-75171556 GGAGTTTGAGATGACCAGCCTGG - Intergenic
1056201312 9:84279659-84279681 GGAGTTTGAGACCAGCTGTCAGG - Intronic
1056821828 9:89847899-89847921 GGAGTTAGAGAATAATAGCCTGG + Intergenic
1058565404 9:106279117-106279139 GGAGTTAGAGACCACCAGCCTGG - Intergenic
1059487135 9:114635468-114635490 AGAGTTCAACACCAGCAGCCTGG + Intronic
1061314967 9:129789521-129789543 GGAGTTCGAGACCATCATCCTGG + Intergenic
1185818421 X:3178995-3179017 GGAATTCAAGACCACCAGCCTGG + Intergenic
1188161926 X:26814889-26814911 GGAGTTCGAAACCAGCAACATGG - Intergenic
1188317107 X:28688414-28688436 GGAGTTCAACACTACTAGCCTGG - Intronic
1189287074 X:39859185-39859207 GGAGTTTGAGACGACCAGCCTGG + Intergenic
1189986732 X:46559849-46559871 TGAGTTGGAGATTAGCACCCAGG - Intergenic
1190340013 X:49288922-49288944 GGAGTTTGAGACCACCAGCCTGG + Intronic
1190806742 X:53844937-53844959 GGAGTTTGAGATGATCAGCCTGG - Intergenic
1192072241 X:67953282-67953304 GGAGTTTGAGACTAGCAACATGG - Intergenic
1195004501 X:100672578-100672600 GGATTTCAACACCAGCAGCCTGG + Intergenic
1195232311 X:102861935-102861957 GGAGTTCGAGACCACCAGCCTGG - Intergenic
1197241395 X:124126897-124126919 GGAGTTCAAAACTGGCTGCCTGG + Intronic
1197241517 X:124127519-124127541 GGAGTTCAAAACTGGCTGCCTGG - Intronic
1197698564 X:129577583-129577605 GGAGGTCTAGACCAGCAGGCAGG + Intronic
1198105003 X:133453829-133453851 GGAGATCGAGACCACCATCCTGG - Intergenic
1200105853 X:153711695-153711717 GGAGTCAGAGACGACCAGCCTGG + Intronic
1200749880 Y:6935072-6935094 GGAGTCCAAGACCAGCAGCCTGG - Intronic