ID: 998562778

View in Genome Browser
Species Human (GRCh38)
Location 5:143186752-143186774
Sequence TGCACAGCAAAGCTCCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998562778_998562780 -8 Left 998562778 5:143186752-143186774 CCATTGGGGAGCTTTGCTGTGCA 0: 1
1: 0
2: 4
3: 11
4: 155
Right 998562780 5:143186767-143186789 GCTGTGCAGACACAGTGACAGGG 0: 1
1: 1
2: 10
3: 36
4: 362
998562778_998562779 -9 Left 998562778 5:143186752-143186774 CCATTGGGGAGCTTTGCTGTGCA 0: 1
1: 0
2: 4
3: 11
4: 155
Right 998562779 5:143186766-143186788 TGCTGTGCAGACACAGTGACAGG 0: 1
1: 0
2: 1
3: 33
4: 249
998562778_998562781 7 Left 998562778 5:143186752-143186774 CCATTGGGGAGCTTTGCTGTGCA 0: 1
1: 0
2: 4
3: 11
4: 155
Right 998562781 5:143186782-143186804 TGACAGGGCTGTGCTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998562778 Original CRISPR TGCACAGCAAAGCTCCCCAA TGG (reversed) Intronic
903446216 1:23424390-23424412 TGCTCAGCAAGGGTCCCCAAGGG + Intronic
905302495 1:36995317-36995339 TGCAAAACAAAGGTGCCCAAGGG - Intronic
909950744 1:81717314-81717336 GGCACAGCATGGCTCCCAAAAGG + Intronic
911324068 1:96448187-96448209 TGAACAGTAAAGCGACCCAAAGG - Intergenic
914335953 1:146715105-146715127 TACACTCCAAAGCTCCCCACGGG - Intergenic
914783447 1:150806756-150806778 TACAGAGCAAAGCTCACCACAGG + Exonic
916406784 1:164505931-164505953 AGCACAGGAATGCTGCCCAAAGG - Intergenic
919117075 1:193294080-193294102 TTCACAGTACAGATCCCCAAAGG + Intergenic
919188928 1:194190216-194190238 TGAACAGCAAAGCCACCCAGAGG - Intergenic
920042464 1:203110853-203110875 TGTACAGCAAAGCTACATAAGGG + Intronic
923660154 1:235950614-235950636 TGCACAGCCCGGCTCCCCACTGG - Intergenic
1065455820 10:25905577-25905599 TGCACTCCAAAGCTTCCCCATGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069925885 10:71850824-71850846 GGCACAACACAGCTGCCCAAGGG + Intronic
1070542573 10:77427108-77427130 TGCACAGCAATTCTTCCCAAAGG + Intronic
1071089195 10:81899214-81899236 TGCACAGCATGGTTCCCCACTGG - Intronic
1074675658 10:115847782-115847804 TGTACAGCACAGCTACCTAAAGG + Intronic
1076872891 10:133202255-133202277 TGCAGAGCGAGGCTGCCCAAGGG - Intronic
1078668415 11:13344655-13344677 TGCAAAGCAAGGCTCGCCACAGG + Intronic
1081494945 11:43598876-43598898 TGCACATCACATCTGCCCAATGG + Intronic
1081648624 11:44807900-44807922 TGCACACCCCAGCTGCCCAAGGG + Intronic
1084550438 11:69838271-69838293 TGCATAACAAACCACCCCAAAGG + Intergenic
1084726389 11:70945187-70945209 TCCCCAGCAAAGCACCCCGAGGG - Intronic
1085739036 11:79063592-79063614 GGCTCAGCAAAGCTGCCCAAGGG + Intronic
1094023249 12:25936386-25936408 TGGACAGCAAAGCTCACCAACGG + Intergenic
1095236119 12:39798108-39798130 AGGACAGCCAAGCTGCCCAATGG + Intronic
1095552770 12:43462950-43462972 AGCACAGAAAAGCTTCACAAAGG - Exonic
1099234193 12:80062797-80062819 TGCTCAGCAAAGCTCACCAATGG + Intergenic
1099706109 12:86154601-86154623 TGCACAGTGAATCTGCCCAACGG + Intronic
1099888843 12:88564604-88564626 TGCAAAGAAAAGCTCCAAAAAGG - Intronic
1101238200 12:102811352-102811374 TGCCCCGCCAAGCTCCCCACAGG + Intergenic
1101510462 12:105388279-105388301 TTTACAGCAAAGCTCCTCAAAGG + Intronic
1101964208 12:109271260-109271282 CGCACAGCAAAGCCTCCCTATGG + Intergenic
1102409781 12:112707699-112707721 TGCTCTGCAAATGTCCCCAAAGG - Intronic
1103158642 12:118708646-118708668 TCCACAGCAGAGAGCCCCAAGGG - Intergenic
1105409911 13:20162350-20162372 TACACCGCAAAGTTCCCAAAGGG - Intergenic
1113946353 13:114046367-114046389 TGCACAGCAGGACTCCCCACGGG + Intronic
1114549852 14:23526462-23526484 TGCAGAGCGGAGCTCCCCAGTGG + Exonic
1117425768 14:55594988-55595010 TGCACAGAAAAGCACCACTAGGG + Intronic
1118000966 14:61523171-61523193 TGCACAGCAAATCTCTCAAGTGG - Intronic
1118809591 14:69263144-69263166 TGCACAGCAAGGCTTCTTAAAGG + Intronic
1119167369 14:72505962-72505984 CACATAGCAAAGCTCTCCAAGGG - Intronic
1122403156 14:101479342-101479364 GGCCCAGGAAAGCTCCTCAAAGG - Intergenic
1124192502 15:27592732-27592754 TGCCCAGAGAAGCTACCCAAAGG + Intergenic
1125881580 15:43200180-43200202 TGTGGGGCAAAGCTCCCCAAAGG - Intronic
1134538345 16:15044665-15044687 TCCAGAGCAAAGTTCCCCACTGG - Intronic
1136363041 16:29793712-29793734 TGCACAGGACAGCCCCACAACGG + Intronic
1138865044 16:60807787-60807809 TGCACAGGAGAGTTTCCCAAAGG - Intergenic
1139281558 16:65774891-65774913 AGAACAGCAAATCTCCTCAAAGG - Intergenic
1139949106 16:70660676-70660698 TGCAAAGCAAAGCAAACCAAAGG - Exonic
1139997671 16:70996118-70996140 TACACTCCAAAGCTCCCCACGGG + Intronic
1140034147 16:71359995-71360017 TGCACTGCACAGCCCCCCAGGGG + Intronic
1143252353 17:5532967-5532989 TTCAGAGGAAAGCTCCCCAGAGG - Exonic
1143574186 17:7780341-7780363 TGGACAGAGGAGCTCCCCAAGGG + Intronic
1144327178 17:14193582-14193604 TCCACTGCAAACCTCACCAAAGG - Intronic
1144476066 17:15590445-15590467 TCCACTGCAAACCTCACCAAAGG - Intronic
1144659532 17:17059280-17059302 TGTACAGTAGAGCTGCCCAAAGG - Intronic
1145096928 17:20037514-20037536 TGCAGAGCAGAGCTACCCATAGG + Intronic
1145230289 17:21168992-21169014 AGCCCAGCAAGGCTCCCCAGTGG - Intronic
1145766323 17:27460583-27460605 TGCTCAGGAAAGCAGCCCAAGGG - Intronic
1146125635 17:30229086-30229108 TGCACAGCCAATCTTCCCGATGG - Intronic
1146991549 17:37278063-37278085 TGCACAGCAAAACTACGTAAAGG + Intronic
1150291462 17:63984862-63984884 TGCCCAGCCGAGTTCCCCAAGGG - Intergenic
1151775151 17:76196092-76196114 TGCAGAGCAGGGCTACCCAAAGG - Intronic
1152212129 17:79008319-79008341 TTCTCAGCAAAGCTCCTCAGAGG + Intronic
1155160187 18:23189436-23189458 AGCACAGCACAGCTCAGCAATGG - Intronic
1155434333 18:25795624-25795646 TCCGCAGCAGAGCTCGCCAAAGG - Intergenic
1157600924 18:48892779-48892801 TGCACTGGAAAGGGCCCCAAAGG + Intergenic
1157868760 18:51210045-51210067 TGCACAGTAAAACTTCCCAAAGG + Intronic
1159507227 18:69353594-69353616 TGCATCCCAAAGCTCCCCAGTGG + Intergenic
1159846334 18:73465289-73465311 TCCACATCAAAGTTCCTCAAGGG + Intergenic
1161933223 19:7355310-7355332 TGCACACCCAGGCTCCCCGAGGG + Intronic
1162969492 19:14171672-14171694 TGCACAGCAGCACTGCCCAAAGG - Intronic
1163170618 19:15528488-15528510 TGCCCTCCAAAGCTCCCCAGTGG + Intronic
1163411551 19:17158089-17158111 CGCACAGGACAGCCCCCCAATGG + Intronic
1164505509 19:28857634-28857656 TGCACTTGAAACCTCCCCAAGGG + Intergenic
1165949375 19:39465398-39465420 TAAACACCAAAGCTCTCCAATGG - Intronic
925596039 2:5556236-5556258 TGCACAGCACATCTCTCAAAGGG + Intergenic
927516013 2:23672070-23672092 TGCAAAGCTATGCTCCCCCAGGG - Intronic
929969329 2:46560148-46560170 TGCACAGCAGACCTCCCTGAGGG - Intronic
930902793 2:56528027-56528049 TGCAAAGTAAATTTCCCCAAGGG - Intergenic
931772013 2:65505508-65505530 TGCACAGGACAGCTGCCCACAGG + Intergenic
932200056 2:69818307-69818329 AGGAAAGCAAAGCTCCCCAGAGG + Intronic
934800031 2:97145885-97145907 TGCACTTCAAAGCTCCTCAGTGG - Intronic
934916774 2:98306408-98306430 TGCCCAGCGATGCTCCTCAAGGG + Intronic
937439254 2:121902890-121902912 TGCACAGCAAAGCCCCCTTGGGG - Intergenic
938380146 2:130831976-130831998 TATACAGCAGAGCTCCCTAAAGG + Intergenic
939275359 2:139991608-139991630 AGCACACCAAAGCTGCCCTAAGG - Intergenic
939772741 2:146343011-146343033 CTCACAGCAAAGCTTCACAATGG - Intergenic
940897576 2:159095393-159095415 TGAACAGAAAAGCCCCACAATGG - Intronic
943533617 2:189119176-189119198 TGCACAGCAAAGCTCTTCATTGG + Intronic
943611096 2:190035523-190035545 TGCACAGCAGGGCTACCCCATGG + Intronic
945194025 2:207221405-207221427 TGCGCAGAAAAGCTGCACAAAGG + Intergenic
945918443 2:215729641-215729663 TGTAAAGAAAAGCACCCCAAGGG + Intergenic
948189578 2:236047305-236047327 TGCACAGCCCACCTCCCCACTGG - Intronic
1170487186 20:16830229-16830251 TGAACAGCAAAGCAGGCCAAGGG - Intergenic
1176789268 21:13300147-13300169 TTCACAGAAAATATCCCCAACGG + Intergenic
1183216379 22:36482694-36482716 TGTAAAGCTAAGCTCCTCAAAGG + Intergenic
1184964056 22:47954134-47954156 TGCAGAGCAGGGCTCCCCCATGG + Intergenic
1185127898 22:49021931-49021953 GGCCCAGCCAACCTCCCCAAGGG - Intergenic
952333195 3:32383573-32383595 TGCATATCAAAGCAACCCAAAGG - Intergenic
959338537 3:105097848-105097870 TGCACTTCCAAGCTCACCAAAGG - Intergenic
962037425 3:131667523-131667545 GGCACAGGACAGCTCCCCACAGG + Intronic
962391981 3:134980023-134980045 TGCATAGCAAAACACCTCAATGG + Intronic
966832948 3:184026478-184026500 TGAACAGCAAAGCGACCCACAGG + Intergenic
971303144 4:25458167-25458189 TCCTCAGTGAAGCTCCCCAAAGG - Intergenic
972869903 4:43284920-43284942 TGCATAGCACAGCTCCAAAATGG - Intergenic
975300680 4:72787264-72787286 TGCCCAGCAAGGCTCCTCAGTGG - Intergenic
975648511 4:76568799-76568821 TGCACAGCACTGCTCCCTGAGGG - Intronic
976313174 4:83632941-83632963 TGCACAGAAGAGTTCCCCACAGG + Intergenic
978155564 4:105485949-105485971 TGAACAGCAAAGCGACCCAAAGG - Intergenic
982274668 4:153627114-153627136 TGCACAGGAAAGCTCTTCATGGG + Intronic
982790794 4:159589150-159589172 TGCACAGCAAAGATGGGCAAAGG + Intergenic
983100313 4:163618015-163618037 TGGACAGAAAAACTCTCCAAAGG - Intronic
984252589 4:177352273-177352295 AGCACAGCAAAGCTGTGCAAGGG - Intronic
985266539 4:188156727-188156749 TGCACTGCAAGGCGTCCCAAAGG + Intergenic
985776875 5:1848927-1848949 TGCACAGCAAAGCGCCCCTCAGG - Intergenic
986053546 5:4112849-4112871 TGCTCAGCACAGATCTCCAAGGG - Intergenic
987107223 5:14652047-14652069 CGAACAGCAAAGCGACCCAAAGG + Intergenic
989322783 5:40156482-40156504 GGAACAGCAAACCTCACCAAGGG - Intergenic
992935613 5:81700994-81701016 TGCAAAGAAAAGCTTCCTAAAGG - Intronic
993230979 5:85236019-85236041 CCCCCAGCCAAGCTCCCCAAAGG + Intergenic
994138827 5:96319963-96319985 GGCATAGCAAAGATCCCAAAAGG + Intergenic
994801299 5:104380504-104380526 TGCACAGCAGGGCTACCCAATGG - Intergenic
996516941 5:124381273-124381295 TGCAAAGCAAAGCTTTCCACCGG - Intergenic
997727493 5:136133392-136133414 TGCACTGCGAAGCTGTCCAATGG + Intronic
998561248 5:143173706-143173728 TGGACAAAAAAGCTCCCAAATGG - Intronic
998562778 5:143186752-143186774 TGCACAGCAAAGCTCCCCAATGG - Intronic
999172372 5:149606388-149606410 TTCTCAGCAAAGATCCCCATGGG - Intronic
999929054 5:156410703-156410725 TGGACAGTCAAGCTCCCCCATGG + Intronic
1001036008 5:168296764-168296786 TTCACATCACAGCTCCACAAAGG - Intronic
1003490671 6:6618797-6618819 AGCACAGCAAGGCTCCCCAATGG - Intronic
1003949794 6:11106770-11106792 TGCACAGTAAAGGACACCAAAGG - Intronic
1006676837 6:35770790-35770812 TGAACAGGGCAGCTCCCCAAAGG - Intergenic
1007367397 6:41404669-41404691 TGCAGAGCAAAGCTCCCAGGAGG + Intergenic
1007502546 6:42309680-42309702 TGGACAGCACAGCTCTACAAAGG - Intronic
1012792816 6:103720633-103720655 TGCACATGAAAGCTCCAGAAAGG - Intergenic
1017651145 6:156583622-156583644 TGAACAGCAAATCTCTCCAGTGG - Intergenic
1020209546 7:6148372-6148394 TATACAGCAAACCTCACCAATGG + Intronic
1021081905 7:16374534-16374556 TGCACTGCTCAGCTCCCAAATGG + Intronic
1021616849 7:22510721-22510743 CGAACAGCAAAGCGACCCAAAGG + Intronic
1021622615 7:22563514-22563536 TGCTCAGCAGAGATCCCCATAGG - Intronic
1023491273 7:40744733-40744755 TGCTCAGCAAAACTCCTTAAGGG - Intronic
1023761651 7:43469896-43469918 TGCAAAGCCACGTTCCCCAAAGG + Intronic
1024823198 7:53358513-53358535 TGCAAAGCAGTGCTCCCCATAGG + Intergenic
1028259203 7:88640291-88640313 TGAACAGCAAAGCAACCCAAAGG - Intergenic
1029641785 7:101825462-101825484 TCCGCAGCACAGCTCTCCAAGGG - Intronic
1033015367 7:137665409-137665431 TGAACAGCAAAGCTGCCCAAGGG - Intronic
1033346990 7:140533376-140533398 TGTACAGCAAGGAGCCCCAAGGG - Intronic
1036188433 8:6646660-6646682 TGCACAGGACAGCTCTCCACAGG - Intergenic
1036435469 8:8729220-8729242 TGCGCAGCACAGATCTCCAAAGG + Intergenic
1038220504 8:25602789-25602811 TGCACCTCAAGGCTCTCCAAAGG - Intergenic
1040404490 8:47086706-47086728 AGCACAGCAAAGCTGCTCTACGG + Intergenic
1048790960 8:138102986-138103008 TGCACAGGACAGCTCCCACAAGG + Intergenic
1049217314 8:141414237-141414259 TGGACAGGACAGCTCCACAATGG - Intronic
1049460349 8:142724477-142724499 TGCACAGCGAACCTCTCCCAGGG - Intergenic
1055285805 9:74726892-74726914 TGCACAGCCAAGCTGCCCACTGG - Intronic
1057288154 9:93777323-93777345 TGGCCAGCAAACCTTCCCAAAGG - Intergenic
1060493753 9:124103059-124103081 GGCCCAGCCAAGCTCCCCAGTGG + Intergenic
1061784790 9:133020743-133020765 CGAACAGCAAAGCGACCCAAAGG - Intergenic
1062131239 9:134894567-134894589 TGCAGAGCAGGGCTCCCCATAGG - Intergenic
1062177544 9:135172439-135172461 TGCTCAGCAGGGCTCCCCATAGG - Intergenic
1203791378 EBV:153580-153602 TGAAAAGCAGAGCTCCCCCATGG + Intergenic
1185571797 X:1140301-1140323 TGCTCGGCAAAGCTCAGCAAAGG - Intergenic
1186086514 X:5996341-5996363 AGCACAGAAAAACGCCCCAAAGG - Intronic
1190461103 X:50676395-50676417 TGCAAGGCAAAACTCCCCTATGG + Intronic
1191936654 X:66434346-66434368 AGAACTGCAAAGCTCCCCATTGG - Intergenic
1194408268 X:93525175-93525197 TGCACAGCAAAGGATACCAAGGG - Intergenic
1195059174 X:101177405-101177427 TGCCCAGCAAAGCCCACCACTGG - Intergenic
1196715864 X:118810477-118810499 TCCATAGCAAAGCTCTTCAAAGG + Intergenic
1199760374 X:150899756-150899778 GGCACAGGAAAGCTGCCGAATGG - Intergenic