ID: 998564715

View in Genome Browser
Species Human (GRCh38)
Location 5:143206867-143206889
Sequence CTGGTGATAGCACGTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998564711_998564715 -6 Left 998564711 5:143206850-143206872 CCTGCCTCAGAACAAGGCTGGTG 0: 1
1: 0
2: 2
3: 23
4: 201
Right 998564715 5:143206867-143206889 CTGGTGATAGCACGTGGGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 148
998564712_998564715 -10 Left 998564712 5:143206854-143206876 CCTCAGAACAAGGCTGGTGATAG 0: 1
1: 0
2: 1
3: 13
4: 123
Right 998564715 5:143206867-143206889 CTGGTGATAGCACGTGGGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 148
998564710_998564715 -5 Left 998564710 5:143206849-143206871 CCCTGCCTCAGAACAAGGCTGGT 0: 1
1: 0
2: 5
3: 7
4: 172
Right 998564715 5:143206867-143206889 CTGGTGATAGCACGTGGGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998564715 Original CRISPR CTGGTGATAGCACGTGGGTG TGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900266831 1:1761624-1761646 CGGGTCACAGCCCGTGGGTGTGG - Intronic
900792682 1:4690448-4690470 CTGGTGACAGCTCCTGGTTGTGG - Intronic
901261754 1:7876333-7876355 CTGGTGGTAGCAAGTGGGATGGG - Intergenic
901688797 1:10959461-10959483 CTTGAGAGAGCACCTGGGTGGGG - Intronic
903277034 1:22228910-22228932 CAGGTGACAGGACTTGGGTGCGG - Intergenic
904344995 1:29862037-29862059 CTGGTTTTAGCAGGGGGGTGAGG - Intergenic
904477980 1:30776837-30776859 TTGGTCATATCATGTGGGTGGGG + Intergenic
906476008 1:46169963-46169985 CTGTGGAGAGCACCTGGGTGGGG - Intronic
909678372 1:78263561-78263583 GTGGTGTTAGCACAGGGGTGGGG - Intergenic
910408470 1:86914851-86914873 TTGGTGATAGCGCCTGGGGGAGG + Exonic
911293751 1:96088302-96088324 CAGGTGATTGCACGTGGGAGGGG - Intergenic
913961195 1:143339203-143339225 CTGGAGACACCAGGTGGGTGAGG - Intergenic
914055549 1:144164776-144164798 CTGGAGACACCAGGTGGGTGAGG - Intergenic
914123597 1:144801586-144801608 CTGGAGACACCAGGTGGGTGAGG + Intergenic
915087043 1:153395981-153396003 CAGGTGGTAGCACAGGGGTGAGG - Intergenic
915990712 1:160512689-160512711 CTGGTGACACCACCAGGGTGGGG + Intronic
917524490 1:175774987-175775009 GTGGTGTTAGCACCAGGGTGAGG - Intergenic
920877999 1:209855188-209855210 CTGGTGAGAGCACGTGGCATAGG - Exonic
1062808130 10:440303-440325 TAGGTGATAGCAAGTGGGTATGG - Intronic
1063772224 10:9216541-9216563 ATGGTGCTAGCACTTGGGGGAGG - Intergenic
1065695215 10:28373475-28373497 CTGGAGACAGCATTTGGGTGAGG + Intergenic
1067965608 10:50909481-50909503 CTGGTAGTAGCAAGTGTGTGAGG + Intergenic
1068262015 10:54594985-54595007 CTGGTGTTAGCACAGGGATGGGG - Intronic
1068588657 10:58830443-58830465 CTGCTGAGAGCACGTGAGAGTGG - Exonic
1070816897 10:79330058-79330080 AGGGTGATAGCCAGTGGGTGTGG - Intergenic
1070917978 10:80167095-80167117 GTGGTGATAGAAGGTGGATGTGG - Intronic
1071475150 10:86019371-86019393 CTGATGAGAGCAGGTGGCTGAGG - Intronic
1072793624 10:98337579-98337601 CGGGTGAGAGCACCTGGCTGTGG + Intergenic
1073050324 10:100662959-100662981 TTGGTCATAGCAAGTGGGTGTGG - Intergenic
1073499140 10:103920000-103920022 CTGCTTATACCACCTGGGTGTGG - Intergenic
1074161864 10:110842210-110842232 CTGGTGGCAGCTGGTGGGTGGGG + Intergenic
1074508573 10:114093204-114093226 CTGGTGATGCCATGTGGGTACGG + Intergenic
1076993974 11:289440-289462 CTGTTGGTGGCACGTGGGGGCGG - Intronic
1077035608 11:493026-493048 CAGGTGGTAGCAGGTGGGGGTGG + Intergenic
1077716271 11:4583836-4583858 CTGTTGTTGGCACCTGGGTGTGG + Intergenic
1078290382 11:10004999-10005021 CTGGTGGTGGCATGGGGGTGGGG - Intronic
1078341525 11:10500929-10500951 CTGGTGCTAGTTGGTGGGTGTGG + Intronic
1084369128 11:68726939-68726961 CTTGTGATAGCAGGAGGTTGAGG + Intronic
1085393866 11:76196444-76196466 CTGCTGAATGCATGTGGGTGCGG - Intronic
1085923561 11:80988170-80988192 CTGGTGAAAGCACCTGCGTTTGG - Intergenic
1087425566 11:97981497-97981519 GTAGTGATAGCAGCTGGGTGCGG - Intergenic
1089203272 11:116738512-116738534 CTGGTGTGTGCACGTGGGTGGGG + Intergenic
1091850433 12:3692810-3692832 GTGGTGGTAGCATGGGGGTGAGG + Intronic
1092513567 12:9184400-9184422 GTGGTGTTAGCATGGGGGTGGGG - Intronic
1095135287 12:38593836-38593858 ATGGTGGTAGCACTTGGGTAAGG - Intergenic
1095517419 12:43021654-43021676 CTGGTAAAAGGAGGTGGGTGTGG + Intergenic
1098243191 12:68488721-68488743 CTGGCGATAGCTGGTGGGAGAGG + Intergenic
1099394570 12:82121567-82121589 TTTGTGATAGCATGTGGGTGGGG - Intergenic
1101471174 12:104998760-104998782 GTGGTGTTAGCATGGGGGTGGGG + Intronic
1101959812 12:109240268-109240290 CTGGGGACTGCATGTGGGTGGGG + Intronic
1102432916 12:112897649-112897671 CTGGTGAGAGCAAGGGGGTGAGG - Exonic
1107988240 13:45794332-45794354 CTGGTATTAGCACATGGGTATGG - Intronic
1109136361 13:58656476-58656498 CTTGTGGTGGCACCTGGGTGAGG + Intergenic
1117638791 14:57775132-57775154 ATGGTGTTAGCACAGGGGTGGGG - Intronic
1118348292 14:64955609-64955631 CTGCTGAGAGCACAGGGGTGGGG - Intronic
1120723807 14:87916262-87916284 GTGGTGGTAGCACGGGGCTGGGG + Intronic
1124232737 15:27959622-27959644 CTGGTGCCAGCCCCTGGGTGCGG + Intronic
1126860055 15:52874493-52874515 CTGGTGCTAGGAACTGGGTGAGG + Intergenic
1127981070 15:64035549-64035571 CTGGTGATAGAACCAGGGTGGGG - Intronic
1128682454 15:69661839-69661861 CTGATGATAGGATGAGGGTGGGG + Intergenic
1136271055 16:29148516-29148538 CTGCTCATGCCACGTGGGTGTGG - Intergenic
1137394056 16:48104737-48104759 CTGGCTAGAGCATGTGGGTGGGG - Intronic
1137618483 16:49860064-49860086 CTGGTGAATGCACGAGGGTCTGG + Intergenic
1141459113 16:84166726-84166748 CTGGTGCTGGCAGGTAGGTGAGG - Intronic
1142114528 16:88349415-88349437 CTGGTGTGTGCACTTGGGTGTGG - Intergenic
1142559230 17:800144-800166 GGGGTGATCGAACGTGGGTGTGG + Exonic
1144383276 17:14724378-14724400 CTCGTGATAGCATGAGGGTTAGG + Intergenic
1144684396 17:17216380-17216402 CTGAGGAGAGCACGTGGGGGGGG + Exonic
1148820948 17:50359377-50359399 CTTGTGATAGGACGTGGTGGGGG - Intronic
1148848968 17:50545282-50545304 CTGTTGAGACCATGTGGGTGTGG - Intronic
1148955014 17:51346317-51346339 CTGGGGATAGCAGATGGGGGAGG + Intergenic
1152026192 17:77811012-77811034 CTGGTATGAGCATGTGGGTGTGG - Intergenic
1159925715 18:74267591-74267613 CAGGTTATAGCACTTGGGGGTGG + Intronic
1161101336 19:2423553-2423575 CTGGAGACAGCAGGTGGGTATGG + Intronic
1161583846 19:5094612-5094634 CTGGTGATAGGACAGAGGTGGGG + Intronic
1163323498 19:16588194-16588216 CTGGTGATAGCACGCTGGGTGGG + Intronic
1163726334 19:18925042-18925064 CAGGTGGTAGGACGTGGGTAGGG + Intronic
1165447826 19:35866358-35866380 CTGGTGAAAGCTCGAGGGTGGGG - Exonic
1165690077 19:37856131-37856153 CTGGTGATAGCAGATGAGGGTGG + Intergenic
1202695032 1_KI270712v1_random:117453-117475 CTGGAGACACCAGGTGGGTGAGG - Intergenic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
927851613 2:26503378-26503400 CTGGTGAGAGCGCTTGGGCGAGG + Intronic
928879509 2:36082232-36082254 GTTGAGATAGCATGTGGGTGTGG + Intergenic
931925791 2:67071155-67071177 CTGGGGATGGCAGGTAGGTGGGG - Intergenic
934276202 2:91574502-91574524 CTGGAGACACCAGGTGGGTGAGG - Intergenic
937466647 2:122138778-122138800 CTGGTGCTGGCAGGTGGGAGGGG - Intergenic
937798916 2:126058955-126058977 CTGGTGGTAGCAGGGAGGTGAGG + Intergenic
938387099 2:130874319-130874341 CTGGTGGAAGCACATTGGTGGGG + Intronic
943094584 2:183413310-183413332 CTGGTAATAGGAAGTGGGGGTGG + Intergenic
946028097 2:216684329-216684351 CTGTTAATAGCACCGGGGTGTGG - Intronic
1173290913 20:41714544-41714566 CAGGTCATAGCAAGAGGGTGGGG + Intergenic
1175646828 20:60681650-60681672 CTTGTGGGAGGACGTGGGTGTGG - Intergenic
1177513312 21:22117807-22117829 CTGGTGATTTCATGTGTGTGTGG - Intergenic
1179015558 21:37592151-37592173 CTGTTTATTTCACGTGGGTGTGG + Intergenic
1179534670 21:42043869-42043891 CTGATGATAGCTTGTGAGTGAGG + Intergenic
1182149117 22:28016406-28016428 CTGCTGAGAACACGTGTGTGTGG - Intronic
1182894792 22:33850195-33850217 CTGGTGGTAGGGCCTGGGTGTGG - Intronic
1183747022 22:39697913-39697935 CTGGTGATGCCCTGTGGGTGGGG - Intergenic
949838346 3:8293206-8293228 CTGGAGAAAGCATGTGTGTGGGG - Intergenic
950704322 3:14770552-14770574 CTGGGGACAGGAAGTGGGTGTGG - Intronic
953150274 3:40318388-40318410 CTGGAGATAGCTGGGGGGTGGGG + Intergenic
954410307 3:50367705-50367727 CTGGGGGTAGCAGGGGGGTGGGG + Intronic
966653579 3:182327722-182327744 CCGGTGATTGCCCTTGGGTGAGG + Intergenic
967836069 3:193963944-193963966 CTGGTGACACGACGTGTGTGTGG - Intergenic
969440534 4:7214137-7214159 CTGGGGACAGCTGGTGGGTGGGG + Intronic
972270059 4:37502383-37502405 GTAGTGTTAGCACGTGGGTAGGG + Intronic
972991053 4:44822965-44822987 CTGGGGATTTCACGTGGCTGTGG + Intergenic
974087839 4:57279866-57279888 CTGGAAATAGCCCTTGGGTGAGG - Intergenic
985713685 5:1444545-1444567 CTCGTGATAGCTCATGGGTGAGG - Intronic
985938441 5:3114458-3114480 CTGGTGCTGCCACGTGTGTGGGG + Intergenic
991495246 5:67219857-67219879 CTGGTGAAAGCATGTGGAGGTGG + Intergenic
993556797 5:89349420-89349442 CTGGGGGTAGCAGCTGGGTGAGG + Intergenic
998427409 5:142040540-142040562 CTGGGGATATCACCTGGGTGAGG + Intergenic
998564715 5:143206867-143206889 CTGGTGATAGCACGTGGGTGTGG + Intronic
999709861 5:154308505-154308527 CTGGTGATGCCACGTGGGGCAGG - Intronic
1000288802 5:159850552-159850574 CTGGTGACAGCAGGTAGGAGTGG - Intergenic
1004834133 6:19511676-19511698 GTGGTGTTAGCACATGAGTGGGG + Intergenic
1004902292 6:20205762-20205784 TTGCTGTTAGCAGGTGGGTGGGG - Intronic
1006386631 6:33734676-33734698 CTGGGGAAAGAAAGTGGGTGGGG - Intronic
1006417311 6:33912343-33912365 CTGGTGAGAGGACGTGGGCAGGG + Intergenic
1009995280 6:70889499-70889521 CTGGTGATAGGCCGTAGGCGAGG + Intronic
1010707072 6:79127756-79127778 GTGGTGTTAGCATGGGGGTGGGG - Intergenic
1012490680 6:99779926-99779948 GTGGTGCTAGCACAGGGGTGGGG + Intergenic
1014205931 6:118655322-118655344 CTTGGGATAGGAAGTGGGTGTGG + Intronic
1015873382 6:137799325-137799347 CTGATGATCACATGTGGGTGTGG - Intergenic
1019707274 7:2502692-2502714 CTGGTGGTGGCTCGTGGGAGGGG - Intergenic
1020260589 7:6528719-6528741 CTGGTGGGAGGAAGTGGGTGTGG + Intronic
1020382040 7:7557431-7557453 GTGGTGTTAGCATGGGGGTGGGG - Intergenic
1020551316 7:9608756-9608778 CTGGGCATAGCACATGGTTGAGG + Intergenic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1024076978 7:45826142-45826164 CTGGTAACAGCATGTGGGGGTGG - Intergenic
1025028117 7:55534841-55534863 CTGGGGACAGCATGTGGCTGGGG - Intronic
1027960483 7:84939918-84939940 CTGGAGATGACACGTGCGTGGGG - Intergenic
1036576954 8:10036672-10036694 ATGGTATTAGCAGGTGGGTGGGG - Intergenic
1039311474 8:36322021-36322043 CTGGTGATAGAGCCAGGGTGTGG + Intergenic
1039911993 8:41833324-41833346 GTGGTGATAGCAGGTGTCTGGGG + Intronic
1043952085 8:86320560-86320582 CTGGAGAGAGAACGTGGTTGTGG + Intronic
1044313840 8:90726886-90726908 GTGGTGTTAGCACAGGGGTGGGG - Intronic
1048997314 8:139801983-139802005 CTGCTAAGAGCACCTGGGTGGGG - Intronic
1049217473 8:141414846-141414868 CTGGTGATATCAGGAGGGGGCGG - Intronic
1051509131 9:17858080-17858102 CTGATGATACCACGAAGGTGTGG - Intergenic
1052142434 9:25003928-25003950 GTTGTGTTAGCACGGGGGTGGGG + Intergenic
1053007712 9:34615027-34615049 CTGCTTATAGCACTGGGGTGGGG - Intronic
1053084674 9:35208663-35208685 CTGGTGATGGCAAGTGAATGAGG - Intronic
1054834855 9:69666389-69666411 CTGATGATAGTGGGTGGGTGGGG - Intronic
1055975607 9:81951782-81951804 CTGATGATAGCTTCTGGGTGTGG - Intergenic
1056572579 9:87828624-87828646 ATGGTGTTAGCATGTGGGTGGGG - Intergenic
1056719368 9:89059443-89059465 GTGGTGTTAGGACGTGGGGGAGG + Intronic
1061493210 9:130957483-130957505 ATGGTGACAGCAGGTGGGAGTGG + Intergenic
1062469318 9:136695610-136695632 CTGCTGAGAGCACCTGGCTGCGG + Intergenic
1062475874 9:136727052-136727074 CTGGAGATGACACGTGCGTGGGG - Intergenic
1062682157 9:137787853-137787875 TTGGGGATAGGAGGTGGGTGGGG + Intronic
1188687126 X:33082870-33082892 CACGTGATAGAACGTGGGTTAGG - Intronic
1188797136 X:34481172-34481194 TTGGTGTCAGCATGTGGGTGAGG + Intergenic
1192203970 X:69084081-69084103 CTGGTGAGTGGAGGTGGGTGAGG - Intergenic
1192429749 X:71103820-71103842 CTGGGGCAAGCACATGGGTGGGG - Intergenic
1193749608 X:85326331-85326353 GTGGTGTTAGCACAGGGGTGGGG + Intronic
1193790182 X:85808004-85808026 GTGGTGTTAGCACAGGGGTGAGG + Intergenic
1197893065 X:131285169-131285191 CTGGTTGTAGCAGGTGGGTGTGG - Exonic