ID: 998565257

View in Genome Browser
Species Human (GRCh38)
Location 5:143210882-143210904
Sequence GTCTGAAGGGCACTGTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998565247_998565257 12 Left 998565247 5:143210847-143210869 CCCAACTTGTTCATGCCCTTAAA 0: 1
1: 0
2: 1
3: 8
4: 151
Right 998565257 5:143210882-143210904 GTCTGAAGGGCACTGTTGACAGG No data
998565251_998565257 -3 Left 998565251 5:143210862-143210884 CCCTTAAAGGCCCAGCTGAGGTC 0: 1
1: 0
2: 2
3: 20
4: 137
Right 998565257 5:143210882-143210904 GTCTGAAGGGCACTGTTGACAGG No data
998565252_998565257 -4 Left 998565252 5:143210863-143210885 CCTTAAAGGCCCAGCTGAGGTCT 0: 1
1: 0
2: 3
3: 17
4: 183
Right 998565257 5:143210882-143210904 GTCTGAAGGGCACTGTTGACAGG No data
998565248_998565257 11 Left 998565248 5:143210848-143210870 CCAACTTGTTCATGCCCTTAAAG 0: 1
1: 0
2: 0
3: 6
4: 125
Right 998565257 5:143210882-143210904 GTCTGAAGGGCACTGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998565257 Original CRISPR GTCTGAAGGGCACTGTTGAC AGG Intronic
No off target data available for this crispr