ID: 998565798

View in Genome Browser
Species Human (GRCh38)
Location 5:143214832-143214854
Sequence GACGCCCACATGCAGTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998565798 Original CRISPR GACGCCCACATGCAGTTCTG GGG (reversed) Intronic
900454710 1:2768532-2768554 GATGCTCACCTGCAGTTGTGGGG - Intronic
900456226 1:2776157-2776179 GATGCTCACCTGCAGTTGTGGGG - Intronic
915473907 1:156141336-156141358 GACTCCCACCTGCAGTTCCTGGG + Intergenic
915613496 1:157015350-157015372 GACGCTCACAGGCTGTTATGAGG + Intronic
916141447 1:161702792-161702814 CATGCCCACATGCATTTGTGAGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
922785856 1:228281927-228281949 GATGCCCACGTGCAGATCTGCGG - Exonic
923533157 1:234827658-234827680 GAGCCCCACATGCAGCTGTGGGG + Intergenic
924479342 1:244413647-244413669 GACTCTCACATGGACTTCTGGGG - Intronic
924625013 1:245690209-245690231 GAACCCCACGTGCAATTCTGTGG + Intronic
1063241653 10:4175812-4175834 CAGGCCCACATGGAGGTCTGTGG - Intergenic
1063246566 10:4225799-4225821 GAGGCTCATAGGCAGTTCTGTGG - Intergenic
1066680817 10:37935879-37935901 GGCCCTCACCTGCAGTTCTGTGG + Intergenic
1068615975 10:59117394-59117416 GAGGCTCACATTCAATTCTGTGG - Intergenic
1071217740 10:83427739-83427761 AACACCCACATGCAGTTTTCAGG + Intergenic
1076642444 10:131927918-131927940 GATGCACATATGTAGTTCTGGGG + Intronic
1077328539 11:1973990-1974012 GGTGCCCAGATGCTGTTCTGTGG + Intronic
1077505521 11:2928333-2928355 GACACCCTCATCCAGTCCTGCGG - Exonic
1079569829 11:21929116-21929138 CATGCACACATGCAGTACTGTGG + Intergenic
1083172452 11:60931009-60931031 AAAGCCCAGCTGCAGTTCTGCGG + Intronic
1084171470 11:67403115-67403137 CAGGCCCACTTCCAGTTCTGAGG - Intronic
1084792155 11:71481805-71481827 AACACCCACGTGCATTTCTGTGG + Intronic
1091169910 11:133510781-133510803 GAGTCCAACATGCAGCTCTGGGG - Intronic
1202811517 11_KI270721v1_random:29169-29191 GGTGCCCAGATGCTGTTCTGTGG + Intergenic
1097247232 12:57613258-57613280 GGCTCCAACATCCAGTTCTGGGG - Exonic
1104188881 12:126458792-126458814 GACATCCGCCTGCAGTTCTGTGG + Intergenic
1104765679 12:131328447-131328469 CACGCCCACCTGCATCTCTGGGG - Intergenic
1104797583 12:131530085-131530107 GGTGCCCACTTGCAGCTCTGAGG - Intergenic
1104813592 12:131633413-131633435 CACGCCCACCTGCATCTCTGGGG + Intergenic
1104813629 12:131633545-131633567 CACGCCCACCTGCATCTCTGGGG + Intergenic
1104813645 12:131633610-131633632 CACGCCCACCTGCATCTCTGGGG + Intergenic
1104841675 12:131828737-131828759 GACGCCGACGTGCACTGCTGGGG - Intronic
1104957181 12:132472634-132472656 GCCGGCCGCCTGCAGTTCTGGGG + Intergenic
1106683462 13:32031674-32031696 GGCGCCCAGAGGCAGCTCTGCGG - Exonic
1106837068 13:33645796-33645818 GACCCCCACAGGCATTCCTGTGG - Intergenic
1108578339 13:51807978-51808000 AAGGCCCACATTCAGCTCTGAGG + Intergenic
1119087002 14:71748252-71748274 GACTCCCACATGCCTCTCTGTGG - Intergenic
1119182012 14:72611625-72611647 GAAACCCACAAGCAGCTCTGGGG + Intergenic
1122629275 14:103099865-103099887 GGCACTGACATGCAGTTCTGGGG - Intergenic
1124247155 15:28080633-28080655 CACACCCGCATGCAATTCTGTGG + Intronic
1127336860 15:57995336-57995358 GACACCCAAATGCAGTATTGAGG + Intronic
1129233019 15:74207145-74207167 GAGGCCCACGTGCATTTCTGCGG + Intronic
1130944281 15:88539266-88539288 GGCCCTCACCTGCAGTTCTGGGG + Intronic
1132907670 16:2291444-2291466 CCAGCCCCCATGCAGTTCTGAGG + Intronic
1136683883 16:31983128-31983150 GACGCCCACATGACTTTGTGTGG - Intergenic
1138817039 16:60214536-60214558 GACACCCACATGCAAGTCTCAGG - Intergenic
1147144811 17:38478831-38478853 GACGCCCACATGACTTTGTGTGG - Intronic
1147961857 17:44172394-44172416 GACAACCACATGCAGCTTTGTGG + Intronic
1148485237 17:47986643-47986665 GAGGCCCAAATGCATCTCTGTGG + Intergenic
1151366317 17:73618627-73618649 GACTCCCCCATGCCGTTCTTGGG - Intronic
1152556927 17:81058005-81058027 GATGCCCTCAGGCAGCTCTGGGG + Intronic
1152980081 18:268302-268324 GCCGCGCACATGCGTTTCTGTGG + Intergenic
1153810527 18:8748055-8748077 GGCGGCCACAAGCAGTTCTGAGG - Intronic
1159111918 18:64069560-64069582 GGCACCCACATGCAGGCCTGGGG - Intergenic
1160526443 18:79541205-79541227 GACACACACAGGCAGTTCCGTGG - Intergenic
1164824983 19:31278383-31278405 GACCTCCACATTCAGTTTTGGGG + Exonic
1167423130 19:49415360-49415382 TACGCCCCCAGGGAGTTCTGAGG - Intronic
1168134723 19:54342638-54342660 GAGCCCCACATGCAGATCTATGG - Intergenic
925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG + Intergenic
925406863 2:3611611-3611633 AACACCCACATGCTGCTCTGAGG - Intronic
925570932 2:5312110-5312132 GCTGCCCTCATGGAGTTCTGAGG + Intergenic
926045433 2:9706354-9706376 GAGGCCCACAGGCAGTTCAAGGG + Intergenic
929192580 2:39153259-39153281 GAGGCACACATCAAGTTCTGTGG - Intergenic
938551245 2:132384277-132384299 GAGACCCACGTGCAGTTGTGGGG + Intergenic
940353733 2:152717567-152717589 GCCGCCGACACGCAGCTCTGCGG + Exonic
941968818 2:171328091-171328113 CACTCCCACCTGCAGTTCTCAGG - Intronic
943276639 2:185876189-185876211 GAGGCCTACATTCTGTTCTGTGG + Intergenic
945357637 2:208857924-208857946 CACACCCACATGAAGTGCTGTGG - Intergenic
947184993 2:227446675-227446697 GACCACCACATTCAGGTCTGTGG + Intergenic
948660512 2:239503627-239503649 AAGCCCCACATGGAGTTCTGTGG - Intergenic
1169692651 20:8349508-8349530 GTCTCCAACTTGCAGTTCTGTGG + Intronic
1171368704 20:24646147-24646169 AAGCCCCACATGCAGCTCTGAGG + Intronic
1178429515 21:32506711-32506733 GATGTCCACATGCACCTCTGTGG - Intronic
1179427357 21:41292286-41292308 GCAGCCCAGAGGCAGTTCTGTGG + Intergenic
1179914336 21:44466796-44466818 GCCGGCCACCTGCAGTTTTGGGG + Intergenic
1179961778 21:44771614-44771636 GCCGACCCCATGCAGTTCTCAGG - Intronic
1180198921 21:46213320-46213342 GCCGCCCTCGTGCAGTGCTGAGG + Intronic
1182096719 22:27630680-27630702 TACACCCACAGGCAGCTCTGGGG - Intergenic
954761889 3:52880783-52880805 GACTCCCACATGCAATTCAAAGG + Intronic
955644253 3:61119670-61119692 GATGGCCACATGCATTTGTGAGG - Intronic
957046723 3:75381352-75381374 GATGTCCACATGCACCTCTGTGG + Intergenic
960964274 3:123093913-123093935 CACCTCCACAGGCAGTTCTGGGG - Intronic
961623015 3:128239539-128239561 GAAGCCCACCTCAAGTTCTGAGG - Intronic
961878789 3:130045420-130045442 GATGTCCACATGCACCTCTGCGG + Intergenic
961930804 3:130530784-130530806 GAGGCCCACATGCATTACTGAGG - Intergenic
970061877 4:12042570-12042592 AACGAACAAATGCAGTTCTGAGG + Intergenic
970218435 4:13783343-13783365 GACCCCTACTTGCAGGTCTGAGG + Intergenic
975808223 4:78135786-78135808 GACTTCCACATACAGTTGTGTGG - Intronic
981753806 4:148119411-148119433 GAAGAGCACATTCAGTTCTGGGG - Intronic
984928185 4:184825382-184825404 GAGGCCCACAGGCAGCTCAGAGG - Intronic
994390575 5:99187816-99187838 GGCTGCCACATGCTGTTCTGTGG + Intergenic
995476451 5:112553096-112553118 CGTGCCCACATGCAGTTATGTGG - Intergenic
998565798 5:143214832-143214854 GACGCCCACATGCAGTTCTGGGG - Intronic
1003170042 6:3713980-3714002 GTCACCCACATGCAGGCCTGAGG - Intergenic
1005312564 6:24572357-24572379 GGAGCCCACAAGCAGTGCTGTGG + Intronic
1007960561 6:45955310-45955332 AACACCCAAATGCAGGTCTGAGG + Intronic
1011356038 6:86474199-86474221 GGCCCCCACCTGCAGTTCCGTGG + Intergenic
1011489203 6:87873326-87873348 GAACCCCACATGCAGCTCTTTGG + Intergenic
1016467042 6:144336089-144336111 AATGCCCACATGCAAATCTGAGG - Intronic
1023249035 7:38237737-38237759 AACACCCACGTGCATTTCTGAGG - Intergenic
1023664330 7:42506070-42506092 GCCACACACATACAGTTCTGGGG + Intergenic
1038997820 8:32945432-32945454 GACACCCACCTGCAGGCCTGGGG - Intergenic
1039489574 8:37937370-37937392 GACGAGTCCATGCAGTTCTGTGG + Exonic
1039689927 8:39852220-39852242 GAGTCCAATATGCAGTTCTGTGG - Intergenic
1049383872 8:142331196-142331218 CAGGCCCACATGCAGCTCAGGGG + Intronic
1056781948 9:89556896-89556918 GACCCCCACATGCGGTTATCGGG - Intergenic
1057186797 9:93061655-93061677 GACACCCACATGTAGTGTTGGGG + Intronic
1060410118 9:123394716-123394738 GAAGCCCACATCCTGTGCTGGGG - Intronic
1061610295 9:131741062-131741084 GAGTCCCACATGCAGGGCTGGGG - Intergenic
1061904741 9:133690843-133690865 CTGGCCCAGATGCAGTTCTGCGG + Intronic
1062425708 9:136505221-136505243 GAGGCCAGCATGCAGTTCTAAGG - Intronic
1190336181 X:49263780-49263802 GTCACACACATGCAGTCCTGGGG + Intronic
1192955902 X:76069584-76069606 GACCCTCAGCTGCAGTTCTGTGG - Intergenic
1195099236 X:101538703-101538725 GCCGCCCACATTCAATTGTGAGG + Intergenic