ID: 998568838

View in Genome Browser
Species Human (GRCh38)
Location 5:143239244-143239266
Sequence CTGCTAGGGTTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998568826_998568838 20 Left 998568826 5:143239201-143239223 CCAGGAGAGAGAAGGAGTGTGGA No data
Right 998568838 5:143239244-143239266 CTGCTAGGGTTGGGAAAAACAGG No data
998568829_998568838 -10 Left 998568829 5:143239231-143239253 CCCCCTCCCTTTCCTGCTAGGGT No data
Right 998568838 5:143239244-143239266 CTGCTAGGGTTGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998568838 Original CRISPR CTGCTAGGGTTGGGAAAAAC AGG Intergenic
No off target data available for this crispr