ID: 998573178

View in Genome Browser
Species Human (GRCh38)
Location 5:143283804-143283826
Sequence CATTTTTCACAGTGTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998573177_998573178 9 Left 998573177 5:143283772-143283794 CCTGTGGAGATTAGGACTTTTGT 0: 1
1: 0
2: 0
3: 8
4: 175
Right 998573178 5:143283804-143283826 CATTTTTCACAGTGTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998573178 Original CRISPR CATTTTTCACAGTGTGCTCC TGG Intronic
No off target data available for this crispr