ID: 998573250

View in Genome Browser
Species Human (GRCh38)
Location 5:143284711-143284733
Sequence GCCTGGAATTCCCCTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998573248_998573250 5 Left 998573248 5:143284683-143284705 CCTCTTTTGGCTGCAGGAAGTAA 0: 1
1: 0
2: 1
3: 13
4: 178
Right 998573250 5:143284711-143284733 GCCTGGAATTCCCCTCCTACTGG 0: 1
1: 0
2: 2
3: 16
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998573250 Original CRISPR GCCTGGAATTCCCCTCCTAC TGG Intronic
900173491 1:1281752-1281774 GCCAGGGCTCCCCCTCCTACAGG + Intronic
901251944 1:7785283-7785305 GCCTCGAGTTCCCCACCTAGAGG + Intronic
901593819 1:10369023-10369045 GCCTGGAATTGCCTTTCTCCAGG + Intronic
901823480 1:11845540-11845562 GCCTCAAATTCCACTCCTAGTGG - Intergenic
902974147 1:20076739-20076761 GCCTTGTAATCCCCTCCAACAGG + Intronic
903703405 1:25267509-25267531 GCCGGGAAGTCCCCGCCTCCTGG + Intronic
903712672 1:25337838-25337860 GCCGGGAAGTCCCCGCCTCCTGG + Intronic
903925778 1:26829448-26829470 GCTTGGAATCCCCTTCCTGCAGG + Intronic
915599243 1:156912379-156912401 GCCTGGAGTTCCCCTTCTGTTGG - Intronic
915663431 1:157423012-157423034 GCCTAGAATTCTCTTCCTCCAGG + Intergenic
915914992 1:159935488-159935510 GTCTGGAATGCCCCTCCCAAGGG + Intronic
918311590 1:183289182-183289204 ACCTGGCACTGCCCTCCTACAGG - Intronic
920301990 1:204994580-204994602 GCCTGGGCCTCCCTTCCTACAGG - Intronic
920607811 1:207407096-207407118 GTCTTGAATTCCCCTCCTCAAGG - Intergenic
920670289 1:207998922-207998944 GCCTGGAATGCCCTTCCCCCAGG + Intergenic
922689680 1:227678281-227678303 GGATGGAATACCCCTCCTAAGGG + Intergenic
1062938730 10:1406543-1406565 GCCTTGACTTTCCCTCCTATGGG + Intronic
1064131037 10:12709894-12709916 TCCTTCAATTCCCTTCCTACTGG - Intronic
1073630684 10:105145613-105145635 GCTGTGATTTCCCCTCCTACTGG + Intronic
1074765476 10:116696917-116696939 GCCCCGAATCCACCTCCTACAGG + Intronic
1075747266 10:124736578-124736600 GCCTGGAATTCCCCTTGCTCTGG - Intronic
1075831933 10:125419324-125419346 GCCTGGAGTGCTCCTCCCACTGG - Intergenic
1079299263 11:19262940-19262962 GCCTAGAATGCCCCTCCTCTGGG - Intergenic
1080640557 11:34155966-34155988 GCCTGGAATGCCCCTCATACAGG + Intronic
1084661336 11:70548329-70548351 GGCTGGATTTCCCTTCCTACTGG + Intronic
1085472612 11:76767901-76767923 GCCTGGAAGGCCTCTCCTCCAGG - Intergenic
1087408412 11:97758892-97758914 GCTTGCATTTCCCCTCCTTCAGG - Intergenic
1090289974 11:125534611-125534633 GACTAGATTTACCCTCCTACAGG - Intergenic
1090634951 11:128685327-128685349 GCCCGGAGTTCCGCTCCTGCGGG + Intergenic
1091284914 11:134403193-134403215 GCCTGGAGATCCCCTCCCCCAGG - Intronic
1095675620 12:44914372-44914394 GCCTGGAATGCTCTTCCTGCAGG + Intronic
1097586684 12:61523817-61523839 GCCTGGACAGCCCCTCCTCCAGG + Intergenic
1101792259 12:107938447-107938469 GCCTGGAATGCTCCTCCTCCAGG - Intergenic
1102253682 12:111404663-111404685 GTCTGGAAATCCCCACCTTCTGG + Intergenic
1103997062 12:124837122-124837144 GCCTGGAGTTCCCGTCATGCAGG - Intronic
1104362746 12:128149332-128149354 TCCTGAAATACCCCTCCCACAGG + Intergenic
1107446824 13:40476885-40476907 GCCTGGAATTCCACTGTTAGAGG + Intergenic
1109525174 13:63566222-63566244 GCCTGGCCTTTCCCTGCTACTGG + Intergenic
1114430664 14:22657665-22657687 GCCTGGAAACCCCCTCCAGCTGG + Intergenic
1117012320 14:51483472-51483494 GCCTGGAATGCCCTTCCTCCAGG - Intergenic
1118818963 14:69332689-69332711 GCCTTGAATTCCCTTTCTCCAGG + Intronic
1119401488 14:74365566-74365588 GCCTGCACTTCTCCTCCTCCTGG - Intergenic
1121368311 14:93334390-93334412 GCCTGAAATTCCCCTCTAGCTGG + Intronic
1121581407 14:95034964-95034986 GCCTGGAAATCCCCTGCAGCCGG - Intergenic
1124424958 15:29555953-29555975 GCCAGGAATTCCCCTTCTTCGGG - Intronic
1127926220 15:63546150-63546172 GCCTGGACCTCCTCTCCTAGAGG + Intronic
1131052403 15:89357577-89357599 GCCTGGAATACTCCTCCCTCTGG - Intergenic
1133019677 16:2961819-2961841 GCCTGGCATTTCTCTCCTATGGG - Intergenic
1133770974 16:8867129-8867151 GCCTGGACTGCCCCTCCTGCGGG + Intronic
1136397140 16:29999287-29999309 GCCCTGAATTCCCCTCAAACAGG - Intronic
1137726071 16:50657576-50657598 GCCTGCATTTCCCCTTCTCCCGG - Intergenic
1138239345 16:55414379-55414401 GCCTGGAATGCTCTTCCTCCAGG - Intronic
1139334117 16:66218992-66219014 GCCAGAAATTACCTTCCTACAGG + Intergenic
1140764194 16:78140565-78140587 GACTGGAATTACCCTGCCACAGG - Intronic
1141325177 16:83050305-83050327 GCCAGCAATTCCACTCCTAGGGG - Intronic
1142780933 17:2180649-2180671 CCCTGGAATTCCCCTCAGAGAGG + Intronic
1145204493 17:20975623-20975645 GCCTAGAATTCCCATTTTACAGG + Intergenic
1146716146 17:35088912-35088934 GGCTGGAAGTCCCCGCCTTCAGG - Intronic
1150396941 17:64829558-64829580 GCCTGTCATTCCCTGCCTACAGG - Intergenic
1151240988 17:72757717-72757739 GTCTGGAAGTCCTCTCCTCCAGG + Intronic
1152753382 17:82076843-82076865 GCCTGGATTCACCCTCCCACCGG - Intergenic
1161450752 19:4344051-4344073 GCCTGGAGTTCCCTTGCTGCAGG + Intronic
1161533837 19:4806552-4806574 GCCTGGAATGCCCTTCCCCCAGG - Intergenic
1162644030 19:12035619-12035641 GCCTGGCTTTCCCCTCCGAGAGG - Exonic
1163790517 19:19303406-19303428 GCAGGGAATTCCTCTACTACAGG - Exonic
1165404691 19:35622433-35622455 GCCTGGAAGTCCCCTTCTGAGGG - Intronic
1166801602 19:45461092-45461114 GCCTGGATTTGCCCTCCCAGAGG + Intronic
1167285419 19:48596367-48596389 ACCTGGAATCACCCTCCTTCAGG - Intronic
926276060 2:11404036-11404058 GCCTGGTGGCCCCCTCCTACCGG + Intergenic
927900295 2:26814024-26814046 GCCTGGAATTCTGTTTCTACAGG - Intergenic
929555815 2:42925037-42925059 GCCTGCCATTCCCCTGCTGCAGG + Intergenic
936232761 2:110718648-110718670 GCCTTGATTTCACCTCTTACTGG + Intergenic
937315324 2:120928335-120928357 GCCTGGAATCTCCCCCCAACAGG + Intronic
937923271 2:127147096-127147118 GCCTTAAATTCCCCTCCTCCAGG - Intergenic
938149401 2:128868987-128869009 GCCTGGAATTCTCCTCCTTCTGG + Intergenic
938943172 2:136187100-136187122 GCCTGGAATTCCACATCTACAGG - Intergenic
939855683 2:147355851-147355873 GACTGAAATTCCCCACCTCCAGG + Intergenic
940496275 2:154432985-154433007 GCCTTGAATCCTCCTCTTACTGG - Intronic
942315699 2:174694570-174694592 GCTTGGAATGCCTTTCCTACTGG + Intergenic
945054831 2:205859411-205859433 GCCAGAATGTCCCCTCCTACAGG - Intergenic
945223900 2:207512180-207512202 GCCTGGAATCCTCCTCCTCCAGG - Intergenic
1170683481 20:18547628-18547650 GCCTGGAATCCCCTTCCCCCTGG + Intronic
1172219800 20:33265878-33265900 GCCTCCAATTCCCCACCTCCTGG - Intergenic
1174366333 20:50058834-50058856 GCCTGGAACTCACTTCCTCCTGG - Intergenic
1178743240 21:35223146-35223168 TCCTGGACTTCCCCTGCTAGTGG - Intronic
1181859278 22:25805670-25805692 AGCTGGAATTGCCCTCATACAGG - Intronic
1183672867 22:39283365-39283387 GCCTGGAAATGCCCTTCTGCAGG + Intergenic
953723658 3:45378862-45378884 ACCTGGAAATCACCTCCTAAAGG - Intergenic
955331888 3:58054097-58054119 GCCTGGAATTGCCCACTCACTGG + Intronic
955928439 3:64030911-64030933 GCCTAGAATTCCCCATCTCCGGG - Intergenic
966746471 3:183281756-183281778 GCCTGCCCTTCCCCTCCAACGGG - Intronic
968807703 4:2786476-2786498 GCCTGCACTGCCCCTCCTCCCGG - Intergenic
968971587 4:3798418-3798440 GCCTGGATTTCCCTTCCTCTTGG + Intergenic
973867154 4:55125472-55125494 GCCTGGATATCCTCTCCTACCGG - Exonic
974803336 4:66847543-66847565 GCTTGGCATTCCCCTCCAAAGGG + Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
977276456 4:94983079-94983101 GCTTGGAATGCTCTTCCTACAGG + Intronic
977330998 4:95637223-95637245 CCCGGGAATGCTCCTCCTACCGG - Intergenic
979186261 4:117798244-117798266 GCATGGCCTTCCTCTCCTACAGG + Intergenic
985904093 5:2819407-2819429 GTCTGGAATGCCCCTGCTGCTGG + Intergenic
986683950 5:10259607-10259629 GCCTGGAATGCTCCTCCCCCAGG - Intronic
998138778 5:139688450-139688472 GCATTAAATTCCCCTCCTGCCGG + Intergenic
998573250 5:143284711-143284733 GCCTGGAATTCCCCTCCTACTGG + Intronic
998855412 5:146390237-146390259 GCCTGGAATGCTCTTCCCACAGG + Intergenic
1001814852 5:174659980-174660002 TCCTTGAACTCCCCTCCCACTGG - Intergenic
1002066185 5:176652940-176652962 GCCAGGAAGGCGCCTCCTACAGG - Intronic
1002202419 5:177537483-177537505 GCCTTGATTTCCCCACCTAAGGG - Intronic
1004207454 6:13605581-13605603 GCATAGAATTCTCCTCCCACAGG + Intronic
1007696613 6:43737750-43737772 GCCTGGAATTTCCCTCCAAATGG - Intergenic
1010214332 6:73388552-73388574 GGCTGGAATCCCCTTCCTCCTGG + Intronic
1011226231 6:85110566-85110588 GCATGCAATTCCTATCCTACAGG + Intergenic
1012930222 6:105308986-105309008 GCCTGGACTGCCCCTACTCCTGG - Intronic
1017285698 6:152673425-152673447 CCCTGGAATTCCTCTCATAAGGG + Intergenic
1017408336 6:154143035-154143057 GGCTGGAATTCCTCTACTCCAGG - Intronic
1017479127 6:154832408-154832430 GCCTGGAATTCCACCCCAACGGG + Exonic
1017749642 6:157479479-157479501 CCCTGGAAATGCCCTCCTGCTGG + Intronic
1017756466 6:157533491-157533513 GCCTGGAACTCCCTCCCTACAGG - Intronic
1018995158 6:168704878-168704900 ACCTGGAATCCCCCTCCCAGAGG + Intergenic
1019064626 6:169286740-169286762 GCCTGGAATGCACCACCTAGGGG + Intergenic
1019847641 7:3522358-3522380 GACTGGAATTTCACTTCTACTGG - Intronic
1022834070 7:34097122-34097144 GCCTAGAAGTCACCTCCTCCAGG - Intronic
1022885631 7:34640572-34640594 TCCTGGCTTTCCCTTCCTACAGG + Intergenic
1022980093 7:35596184-35596206 GCCTGGACTTCTCTTCCTACAGG - Intergenic
1022998684 7:35785092-35785114 GGCTGGTAGTCCCCTCCTAAGGG - Intergenic
1027165082 7:75828574-75828596 TCCTGGAATTCCCTGCCTTCTGG - Intergenic
1028958757 7:96724753-96724775 GCCAGCATTTCCACTCCTACTGG - Intergenic
1029794138 7:102875933-102875955 CCCTGGAATGTCCCTTCTACTGG + Intronic
1039021517 8:33212163-33212185 CTCTGGAATTACCCTCCTAATGG - Intergenic
1039405772 8:37311271-37311293 GTCTGGACTCCCCCTCCTCCAGG - Intergenic
1048133487 8:131722801-131722823 GGCTGGAATTCCATTACTACAGG - Intergenic
1059539094 9:115112878-115112900 GCCTGGAATCCCCCTGCTCCAGG - Intronic
1194448119 X:94011333-94011355 GCCTGGAACTCCTCTGCCACAGG + Intergenic
1196865179 X:120064976-120064998 GCCTGGAATGCTCTTCCTACAGG - Intergenic
1196877914 X:120171304-120171326 GCCTGGAATGCTCTTCCTACAGG + Intergenic
1197980096 X:132208970-132208992 GGCTGGAATTCCTCTGATACAGG + Intronic