ID: 998575610

View in Genome Browser
Species Human (GRCh38)
Location 5:143312258-143312280
Sequence TTGGCCACACAGACCAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998575610_998575613 -1 Left 998575610 5:143312258-143312280 CCAAGATTGGTCTGTGTGGCCAA 0: 1
1: 1
2: 4
3: 32
4: 184
Right 998575613 5:143312280-143312302 ATAAAATATGGCAGAAGTGATGG 0: 4
1: 23
2: 104
3: 333
4: 986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998575610 Original CRISPR TTGGCCACACAGACCAATCT TGG (reversed) Intronic
904982715 1:34520412-34520434 TGGGCCACAGAGACCAGCCTTGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
909478307 1:76107444-76107466 TTTGACAATCAGACCAATCTGGG - Intronic
910160537 1:84267511-84267533 TTGGTCATACAGACCAACCCTGG - Intergenic
912264929 1:108147825-108147847 TTGATCACACAGACCAACCCTGG - Intronic
914799666 1:150951270-150951292 ATGGCCACACTGAGCAACCTTGG + Intronic
914932118 1:151944307-151944329 TTTGCCACACACTTCAATCTTGG - Intergenic
916127240 1:161582178-161582200 TTGACCACACAGACCATGATGGG + Intronic
916137159 1:161663982-161664004 TTGACCACACAGACCATGATGGG + Intronic
916514460 1:165502648-165502670 TTTGTCACACAGACCAATGCTGG - Intergenic
917973383 1:180222941-180222963 TTGGTCACTAAGACCATTCTTGG + Intergenic
918103411 1:181396281-181396303 TTGGTTACACAGACCAACCCTGG + Intergenic
918133471 1:181648826-181648848 TTGGCAACAAAGTCCTATCTGGG + Intronic
919116172 1:193283355-193283377 TTGGTCACACAAACCAATACTGG + Intergenic
919663375 1:200269470-200269492 TTGGTCACACAGACCAACCCTGG - Intergenic
921430033 1:215054769-215054791 TTTTCCACACAAACCAATCAAGG + Intronic
921572209 1:216793303-216793325 TTGGTCACACAGACTAATCCTGG - Intronic
923263538 1:232290058-232290080 CCGGCCACACTGACCACTCTGGG + Intergenic
1065105186 10:22376731-22376753 CTGGCCACACAGACCAGCCCTGG - Intronic
1067804314 10:49382562-49382584 TTAAGCACACAGCCCAATCTAGG - Intronic
1068665362 10:59669336-59669358 TAAGCCACACAGCCAAATCTGGG - Intronic
1069424135 10:68274853-68274875 CTGGTCTCACAGACCAATCATGG + Intergenic
1070057016 10:72945214-72945236 TGGGTCACACAGACCACTCCTGG - Intronic
1072042128 10:91617533-91617555 TTGGCCACACAGAACAACGTTGG + Intergenic
1075304425 10:121355262-121355284 TTGGTCCCACAGACCAGCCTTGG + Intergenic
1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG + Intergenic
1077465288 11:2731047-2731069 TTGGCCTCACAGCTCAACCTTGG + Intronic
1080994253 11:37580791-37580813 TTGCCCACACAGACCACACTTGG - Intergenic
1081699091 11:45141328-45141350 GTGGTCACACAGACCAACCCTGG - Intronic
1082855150 11:57799336-57799358 CTGGCCACCCACACCCATCTGGG - Intronic
1086371523 11:86160016-86160038 TTGGTCACAGAGACCAACCCTGG - Intergenic
1088983254 11:114883003-114883025 GTGGGCACACAGACCATTTTAGG + Intergenic
1090214712 11:124951667-124951689 TTGGTCATACAGTCCAACCTAGG + Intergenic
1093007759 12:14068843-14068865 TTGGCCATGTAGACCAATCTTGG - Intergenic
1093448601 12:19289434-19289456 TAGGCAAAACAAACCAATCTTGG + Intronic
1097329418 12:58317367-58317389 TTGGTCACACAGACCAACCCTGG + Intergenic
1098154691 12:67585506-67585528 GTGGACACAGAGTCCAATCTAGG + Intergenic
1103469119 12:121165878-121165900 TTGGTCACACAGATCAACCCTGG + Intronic
1107796782 13:44061230-44061252 TTGGCCACAAGGACTAATCTGGG - Intergenic
1108334776 13:49428453-49428475 TTGGTCACACAGACCAGTCTTGG + Intronic
1108444788 13:50497302-50497324 TTGGCTACACAGAGGATTCTAGG + Intronic
1110450017 13:75630727-75630749 TTGGCCACATAGAACAATTTGGG - Intronic
1111985727 13:95064992-95065014 TTGGCCAAAGAGACCACTCTTGG - Intronic
1113477982 13:110598940-110598962 TCGGCCACAGAGATCAATTTTGG + Intergenic
1114553056 14:23545134-23545156 TTGGCCAGACAGGGCAATGTGGG - Intronic
1115327799 14:32161737-32161759 CAGGTCACACAGACCAATTTTGG - Intergenic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1117708882 14:58502500-58502522 TTGATAACACAGACCAATCATGG + Intronic
1118886412 14:69870505-69870527 TTGGTCACACTGACCAACCCTGG - Intronic
1119873951 14:78040818-78040840 CTGGTCACACAGACCAACCCTGG - Intergenic
1119887453 14:78154784-78154806 TTGGCAACACAGAGCCAGCTAGG - Intergenic
1120414115 14:84197443-84197465 TTGGCCATTGAGAACAATCTTGG + Intergenic
1121465489 14:94112824-94112846 TCGGCAACACACACCACTCTGGG + Intronic
1121874974 14:97442726-97442748 TGGGCCCCACAGAAGAATCTTGG - Intergenic
1122796763 14:104210013-104210035 TTCCCCACACAGAGCAACCTGGG - Intergenic
1123159066 14:106260030-106260052 TTTCCCACACAGAACCATCTCGG - Intergenic
1123207811 14:106730406-106730428 TTTCCCACACAGAACCATCTCGG - Intergenic
1123212835 14:106777412-106777434 TTCCCCACACAGAACCATCTCGG - Intergenic
1124853887 15:33368467-33368489 AGGGCCACACAGACTAATGTGGG - Intronic
1125337006 15:38636604-38636626 TTAGTCACACAGACCAACCCTGG - Intergenic
1126127978 15:45313746-45313768 TTGGTCACACAGACCAACCCTGG - Intergenic
1126855319 15:52833138-52833160 TTGGCCACACGGCCCAGCCTGGG + Intergenic
1127613400 15:60658761-60658783 TTGGCCACAAAGACTAAACAGGG + Intronic
1128739500 15:70073900-70073922 TGGGCCTCACAGAGCACTCTTGG + Intronic
1131194655 15:90345907-90345929 TTGGTCACACAGACCAACCCTGG - Intergenic
1133697952 16:8282736-8282758 TTGGTCACACAGATCAACCTTGG + Intergenic
1134134445 16:11669685-11669707 TTGGCCAAACAGGCCAACCCTGG + Intronic
1135799377 16:25478458-25478480 TTGGCCACACAGGTCAGTCCTGG - Intergenic
1137419510 16:48319752-48319774 TTGGTCACACAGCCCAACCCTGG + Intronic
1138217790 16:55220010-55220032 TTGGCCAAACAGATCAAGCATGG + Intergenic
1138241087 16:55427747-55427769 TTGGCCACAGAGCCCAATCCTGG + Intronic
1138350431 16:56343675-56343697 ATGGCCACACAGGCCAGGCTGGG + Intronic
1138803654 16:60066150-60066172 TTGATCACACAGACCAACCCTGG + Intergenic
1139681318 16:68566268-68566290 TTGACCATGCAGACCAATTTGGG + Exonic
1143417742 17:6761983-6762005 TTGACCACACAGGCAACTCTTGG - Intronic
1145393056 17:22470824-22470846 TTAGCCAGACAGACCCATTTGGG + Intergenic
1148170285 17:45513785-45513807 GTGCCCACACAGAAGAATCTGGG - Intergenic
1148170762 17:45517778-45517800 GTGCCCACACAGAAGAATCTGGG - Intergenic
1148365263 17:47050774-47050796 GTGCCCACACAGAAGAATCTGGG + Intergenic
1148612948 17:48976897-48976919 TTGGTCACACAGACCAATCCTGG + Intergenic
1150401375 17:64859359-64859381 GTGCCCACACAGAAGAATCTGGG - Intronic
1152047824 17:77949751-77949773 TTGGCCACCCAGACCAACCATGG - Intergenic
1152300437 17:79492328-79492350 TTGGTCACACAGACCAGTGCTGG - Intronic
1153892282 18:9528832-9528854 TTGGACCCACAGACCAATCTGGG - Intronic
1155181599 18:23352979-23353001 TTGGCCACACAGGGCACTTTTGG - Intronic
1157573198 18:48726747-48726769 TTGGTCACATAGACTAACCTTGG + Intronic
1157903271 18:51541676-51541698 TTGGTCACACTGGCCAATCCTGG + Intergenic
1160842562 19:1152745-1152767 TTCGCCCCACAGGCCAACCTGGG + Intronic
1161772095 19:6236447-6236469 TTGCCCACACAAACCAAACAGGG + Intronic
1162207645 19:9067839-9067861 TTGACCACACGGACGAACCTGGG + Intergenic
1162465217 19:10835672-10835694 TTGCCCACACAGGCCTTTCTCGG - Intronic
1164989114 19:32672011-32672033 TTGACCACCCAGACTTATCTGGG - Intronic
1166640805 19:44493631-44493653 TTGGTCACACAGACCCACCTTGG - Intronic
1167409603 19:49337171-49337193 TTTGCCACACAGATCACCCTGGG + Exonic
925930055 2:8699793-8699815 TTGGTCACACAGACCAACCGTGG + Intergenic
926352527 2:12009670-12009692 CTGACCACAGAGACCAATATAGG - Intergenic
928348536 2:30523359-30523381 GTGGTAACACAGACCACTCTAGG + Intronic
930646612 2:53915514-53915536 TTGAGCTCACAGACCAGTCTGGG + Intronic
931893885 2:66707108-66707130 CTGGTCACACAGACCAGCCTTGG - Intergenic
931922730 2:67038401-67038423 TTGGGCACACAGAACAGTCCAGG + Intergenic
934678894 2:96268411-96268433 TGGGCCACACAGACACATGTTGG + Intronic
934728292 2:96639012-96639034 TTAACCACACAAAACAATCTAGG - Intronic
935462444 2:103354210-103354232 TTGGTCACACAGACCAACTCTGG + Intergenic
935842716 2:107130943-107130965 TTTGACACACAGACCTTTCTGGG + Intergenic
937155529 2:119716111-119716133 TTGGCGGCACAGATCACTCTCGG - Intergenic
937878300 2:126843473-126843495 TTGGCCACACAGGCAAACCCTGG + Intergenic
943761822 2:191618350-191618372 TTGGTCACACAGACCAACTTTGG - Intergenic
946074034 2:217059080-217059102 TTGTCCACACAAACCATTATGGG - Intergenic
948150869 2:235743721-235743743 TTGGCCATAAAAACCTATCTAGG + Intronic
948234243 2:236375682-236375704 TTGCCCTCACAGACCAAAATTGG + Intronic
948296069 2:236861571-236861593 TCGGTCACACAGATCACTCTAGG + Intergenic
1168928263 20:1600235-1600257 TTGGACACACAGTCAGATCTGGG + Intronic
1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG + Intronic
1170323385 20:15127789-15127811 TTGGTCACCCAGACCAATGCTGG + Intronic
1170624999 20:18023587-18023609 TTGGCCACAGAGCCCATTCAAGG + Intronic
1170921417 20:20683209-20683231 ATGGCCACACAGACCAGGCAGGG - Intronic
1171160912 20:22922318-22922340 TTCGCCACAGAGACCAGGCTGGG + Intergenic
1171210848 20:23315806-23315828 CTGTCCTCACAGACCAATCCAGG + Intergenic
1172520157 20:35560835-35560857 CTGGCCCCACAGACCATTCCTGG - Intergenic
1173833815 20:46112169-46112191 TTGGTCACACAGACCAACCCTGG + Intergenic
1173944351 20:46938757-46938779 TTGGTCACACAGACCAACCCAGG + Intronic
1175003639 20:55658230-55658252 TTGGTCACACACACCAACCCTGG + Intergenic
1175945524 20:62556750-62556772 ATGGCCACACAAACCCACCTGGG - Intronic
1179594043 21:42430494-42430516 TTGGCCACACAGCTCTCTCTGGG - Intronic
953086073 3:39668829-39668851 ATGGCCACTGAGACAAATCTTGG - Intergenic
953355395 3:42251993-42252015 GTGGCCACACACACAAACCTCGG + Intergenic
956753116 3:72360515-72360537 TTGACAACAGAGACCAGTCTGGG + Intergenic
956877339 3:73476554-73476576 TTGGTCACACACAACAACCTTGG - Intronic
957627401 3:82671257-82671279 TTGGCTACACAGGGCAAGCTAGG + Intergenic
957771350 3:84696303-84696325 TTGGACACATAGAATAATCTAGG - Intergenic
959788175 3:110326665-110326687 TTGGCCACACAGACAGGTTTTGG + Intergenic
960112598 3:113859882-113859904 CTGGCCTCACAGAATAATCTGGG - Intronic
961397373 3:126604984-126605006 CTGGCCACACAGACCAGCCCTGG + Intronic
962769427 3:138598805-138598827 TTGGTCACATAGACCAACCGTGG + Intergenic
963738971 3:149055803-149055825 TTGGTCACACAGACCAGTCCTGG - Intronic
968705669 4:2076277-2076299 CTGGCCACACAGACCGCACTGGG + Intronic
975534092 4:75430983-75431005 TTGGCCCCACAGTACAAACTAGG - Intergenic
975924400 4:79431893-79431915 TTGGCCACACAGACCCTCTTTGG + Intergenic
976817290 4:89163812-89163834 TGGGTCACACAGACCAACCCTGG + Intergenic
977287404 4:95125863-95125885 TGTGCCACACATACCAAGCTGGG - Intronic
979449015 4:120847216-120847238 TTAGTCACACAGGCCAACCTTGG - Intronic
979519860 4:121653514-121653536 CTGGTCACACAGAGGAATCTAGG + Intergenic
981390171 4:144180501-144180523 TTGATCTCACAGACCAATCCTGG + Intergenic
981558403 4:146021299-146021321 TTGGCCAGATATACCATTCTAGG + Intergenic
982307302 4:153946056-153946078 ATGGGCACACAGATCAATGTGGG - Intergenic
983198773 4:164838076-164838098 TTGGTTACACAGACCAACCCTGG - Intergenic
984599372 4:181708870-181708892 TTGGCAACCCAGAACATTCTAGG - Intergenic
986690655 5:10311058-10311080 TTGGTCACACAGACCAACCATGG - Intergenic
987165048 5:15189282-15189304 TTGGCAAAACATAACAATCTAGG + Intergenic
988438012 5:31198561-31198583 TTGGCCAGACCTACCAATTTAGG - Intronic
989793555 5:45438087-45438109 TTGGTAACACAGGCCAACCTTGG + Intronic
990807584 5:59682989-59683011 TTGGCTACACAGAACATTATTGG + Intronic
990876734 5:60494594-60494616 TGGGCCACAAAGAAGAATCTGGG - Intronic
992182379 5:74211299-74211321 TTGGCCACACAGACCAACTGTGG - Intergenic
992361546 5:76043280-76043302 TTGGTCACACAGACCAATCCTGG - Intergenic
993238459 5:85346780-85346802 TGGGCCACACAGGCCAATATGGG - Intergenic
994638357 5:102372044-102372066 TTGGGCACAGAAACAAATCTTGG + Exonic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
997247907 5:132366878-132366900 TTGGTCACATAGACCAATCCTGG + Intergenic
998079607 5:139263578-139263600 TTGGTCACACAGACAAACCCTGG - Intronic
998270680 5:140703669-140703691 TTGGCCAAACAGACCAACTCTGG + Intronic
998575610 5:143312258-143312280 TTGGCCACACAGACCAATCTTGG - Intronic
999340257 5:150764081-150764103 TTGGTCACACAGACCAACCCTGG - Intergenic
999640058 5:153663338-153663360 TGGGCCACACTGCCCAAACTGGG + Intronic
1002169760 5:177368372-177368394 TTGGCTACGCAGAGCAAGCTGGG - Intronic
1004305180 6:14494376-14494398 TTGACTACACAGATCAATTTAGG + Intergenic
1006734805 6:36265886-36265908 TTGGTCACACAGACCAGCCCTGG - Intronic
1008336025 6:50305890-50305912 TTGGCCATACAGACAAACCCTGG - Intergenic
1008787141 6:55182291-55182313 TTGGTCACCCAGACCAATTCTGG - Intronic
1009996533 6:70901477-70901499 TTTGACACACACACCAATGTGGG - Intronic
1013402616 6:109813692-109813714 GTGGTCACAAAGACCAATCCCGG - Intronic
1015785526 6:136919058-136919080 TTAGCTACACAGACCAACCCTGG + Intergenic
1015796716 6:137019984-137020006 TTGGACACACAGACCAACCCAGG - Intronic
1016328604 6:142931983-142932005 CTGGGCACACACACCAATATGGG - Intronic
1017145105 6:151227638-151227660 TTGGGCACACAGTCCAACCCTGG + Intergenic
1017615251 6:156240404-156240426 GTGGGCACAGAGATCAATCTGGG + Intergenic
1020989553 7:15179954-15179976 TTTGCCACTCAGAGCCATCTTGG - Intergenic
1021520488 7:21535329-21535351 TTGGCCACATAAAAAAATCTGGG + Intergenic
1022002300 7:26237428-26237450 TTGGTCACACAGACCAAGGCTGG - Intergenic
1022415481 7:30173335-30173357 TGGGCCACACACAGCACTCTTGG + Intergenic
1022944664 7:35270494-35270516 TTGGTCACACAAGCCAATCCTGG - Intergenic
1023225913 7:37968820-37968842 TTGGACACAGAGACCAAATTTGG - Intronic
1023296375 7:38718979-38719001 TTGGTCACACAAACCAACCCTGG + Intergenic
1028461306 7:91096183-91096205 TTGGTCACCAAGACCAATCCTGG - Intronic
1028559483 7:92158125-92158147 TTGATCACACAGACCAACCTTGG - Intronic
1029306435 7:99623319-99623341 TTGGCCATACAGGCCACACTAGG + Intronic
1029460194 7:100689810-100689832 GTGGCCACCTAGAGCAATCTGGG + Intergenic
1030562222 7:111103308-111103330 TTTCACACACAGACCAATATTGG + Intronic
1031088012 7:117322830-117322852 TTGGCCACATAGACCCTTCCTGG - Intronic
1032839054 7:135699580-135699602 TCGGCCAGACAGCCCAAGCTGGG - Intronic
1033241527 7:139683594-139683616 TGGGTCACACAGACCAATCCTGG + Intronic
1037454860 8:19053022-19053044 TTGGCCACACAGGTAAATTTAGG + Intronic
1037929015 8:22866241-22866263 AAGGCCACGCAGGCCAATCTTGG + Intronic
1038087919 8:24220602-24220624 TTGGCAACACATAGCAGTCTAGG - Intergenic
1038490847 8:27970002-27970024 TTGGTCACACAGGCCAATCCTGG - Intronic
1039190061 8:34963482-34963504 TGGGCCACACAGACCAAAGCTGG + Intergenic
1039324917 8:36474606-36474628 TTGGCCACATAGACCAGCCCTGG + Intergenic
1043425172 8:80141331-80141353 TTGGTCACACAGACCAACCCTGG - Intronic
1045365806 8:101475055-101475077 TTGTTCATATAGACCAATCTTGG - Intergenic
1048312716 8:133338119-133338141 TTGGCCACAAAGACCCTGCTTGG + Intergenic
1049433302 8:142575129-142575151 TTGGCCACAGAGGCGAGTCTTGG - Intergenic
1050163794 9:2743908-2743930 TTGGTCACACAGACCAGCCCTGG - Intronic
1050839693 9:10132894-10132916 TTGGCCATACAGGCCAAAGTGGG - Intronic
1052257671 9:26477859-26477881 TTGGCCACACAGACCAACTCTGG - Intergenic
1053222345 9:36322883-36322905 TTGGTCGCACAGGCCAATCCTGG - Intergenic
1054723097 9:68623359-68623381 CTGGCCAGACAGATCAAGCTGGG - Intergenic
1054763618 9:69024874-69024896 CTGGTCACACAGACCAACCCTGG + Intergenic
1056199372 9:84259718-84259740 TTGATCACACACACAAATCTTGG - Intergenic
1056523281 9:87419716-87419738 TTGGTCACACAGAGCAGTCCTGG + Intergenic
1059706039 9:116824286-116824308 TTGGTCACATAGACCAATTCTGG - Intronic
1062104881 9:134749913-134749935 CTGGCCACACAGACATACCTAGG - Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1186186286 X:7022955-7022977 TAGGGCACACAAACCACTCTGGG + Intergenic
1187075491 X:15930200-15930222 TTGGCCACACAAAACCACCTGGG - Intergenic
1189135706 X:38547190-38547212 TTGGTCACACAGACCAACAATGG - Intronic
1189651577 X:43195504-43195526 TTGGTCACACAGACCAACACTGG - Intergenic
1190939620 X:55027823-55027845 TTGGCCCCACATACCAACCCAGG - Intronic
1192587931 X:72334684-72334706 GTGGCCAAACAGAACAATTTTGG + Intronic
1193523451 X:82559558-82559580 TTGCTCACACAGACCAGGCTGGG - Intergenic
1198406959 X:136322687-136322709 TTGGCAATACAGTCAAATCTGGG - Intronic
1200587977 Y:5032987-5033009 GTGGCCATCCAGGCCAATCTAGG - Intronic