ID: 998576033

View in Genome Browser
Species Human (GRCh38)
Location 5:143317679-143317701
Sequence AATTGCTACAAGGAGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998576030_998576033 25 Left 998576030 5:143317631-143317653 CCATGCATAAAGCTAGATATGTC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 998576033 5:143317679-143317701 AATTGCTACAAGGAGGATTATGG 0: 1
1: 1
2: 0
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998576033 Original CRISPR AATTGCTACAAGGAGGATTA TGG Intronic
901135463 1:6990396-6990418 AATTGATACATGGATGAATATGG - Intronic
901435483 1:9245014-9245036 AGTTGCTCCCAGCAGGATTATGG - Exonic
901971173 1:12910210-12910232 AATTAATTCAAGGTGGATTAAGG + Intronic
903508867 1:23858477-23858499 ATTTGCTACAGTGAAGATTAGGG + Intronic
903930780 1:26861348-26861370 CTTTGCCACAAGGAGGAGTAGGG - Intergenic
903987738 1:27241203-27241225 GATGGCTATACGGAGGATTAAGG - Intronic
905541786 1:38765806-38765828 AATTCCAACTTGGAGGATTATGG - Intergenic
906675251 1:47688532-47688554 AATTTCAACAAGGACGATTTCGG + Intergenic
908308552 1:62851727-62851749 AATAGCTACAAAGAGAACTAAGG + Intronic
908553277 1:65231244-65231266 AATTGTTACAAGAAAGATAAGGG - Exonic
909588191 1:77314655-77314677 AATAGCTAAAAGGAGGATGGAGG - Intronic
911189805 1:94936527-94936549 AATTGTTTCAAGCAGGAATAAGG - Intergenic
916826722 1:168448987-168449009 ATTTGCCTCAAGGAGGAATAGGG + Intergenic
917808197 1:178633168-178633190 AGTTGCTTCTAGGAGGAATAAGG + Intergenic
918989739 1:191683396-191683418 AAATGCTAAAGGGAGCATTATGG - Intergenic
921406369 1:214784146-214784168 AATTGATTCAAGATGGATTAAGG + Intergenic
1065806505 10:29398115-29398137 AATTGCAACAAGAGGGATGAGGG + Intergenic
1067925162 10:50501195-50501217 ATTTACTCCAAGTAGGATTAGGG - Intronic
1068644805 10:59454086-59454108 AATAGCTTCAAAGAAGATTATGG + Intergenic
1069393391 10:67961540-67961562 AATTGTTACACTGATGATTAGGG - Intronic
1069507083 10:69009414-69009436 AAATGCTAGAAGGAATATTATGG - Intronic
1069940150 10:71949677-71949699 AAATGCTAAAAGGAGGAAGAGGG + Intergenic
1070671615 10:78381371-78381393 AATGGCTCCAAGAAGGATCATGG - Intergenic
1070679059 10:78436107-78436129 AATGGCTGCATGGAGGATTGGGG + Intergenic
1072789933 10:98310567-98310589 AATTACTACCATAAGGATTATGG - Intergenic
1073223521 10:101896406-101896428 TAGGGCTACAAGGAGGGTTAGGG + Intronic
1074265673 10:111900807-111900829 AACTGATACAAGAAGGAATAGGG + Intergenic
1077950022 11:6946695-6946717 AACTGCTAAAAGGAAGAGTAAGG - Intronic
1079141189 11:17810827-17810849 AATTGCTGGAAGGAGGTTTTTGG - Intronic
1080188495 11:29519898-29519920 AAATGTTACAAGGGGGATTATGG + Intergenic
1080986471 11:37472889-37472911 AATTGATACATGGAAGACTAAGG + Intergenic
1089320453 11:117623008-117623030 AAGTGCTAGAAGCAGGATTTGGG - Intronic
1092166678 12:6346880-6346902 ACTTGCTCCAAGCAGGATGATGG + Exonic
1093359248 12:18203095-18203117 CACTGCTTCAAGCAGGATTAGGG - Intronic
1097400354 12:59120964-59120986 AATTACTATTAGGAGGATCAAGG + Intergenic
1097879700 12:64675712-64675734 TATTGCTACAAGGAGGATTAGGG + Intronic
1098051587 12:66459598-66459620 AATTGCTACAGGCAGGTTAAAGG + Intronic
1107092932 13:36502302-36502324 AATTGCATCAAGGAATATTAGGG - Intergenic
1107600331 13:42006263-42006285 ATTGGCTACAAAGAGTATTAAGG - Intergenic
1109592881 13:64510095-64510117 AAATCCTACATGGAGGATTGTGG - Intergenic
1111201741 13:84947408-84947430 AATTGCTACAGGTAGAATTTTGG + Intergenic
1111339180 13:86861776-86861798 AATTGGTACCAGGAGGAGTGGGG + Intergenic
1113063874 13:106354830-106354852 ATTTGCTACCAGGAGGCTGAAGG - Intergenic
1113479433 13:110609753-110609775 AATTGCTACAAACCAGATTATGG + Intergenic
1115716624 14:36112716-36112738 TATTGCTACAAGAAGGGATATGG - Intergenic
1120335064 14:83144253-83144275 ATTTCCTATATGGAGGATTAAGG + Intergenic
1122557818 14:102591307-102591329 AATAGCTACAGGGAGAATTTGGG - Intergenic
1123185397 14:106511770-106511792 CATTTCTTCAAGCAGGATTAGGG - Intergenic
1123196590 14:106623015-106623037 CATTTCCTCAAGGAGGATTAGGG - Intergenic
1124194325 15:27607541-27607563 AATGGCTACAAGGAGAATATTGG + Intergenic
1124681819 15:31738471-31738493 GATTGCTCCAAGGAGGATGCAGG - Intronic
1128039276 15:64555954-64555976 TATTGCTACATGTAGGATTATGG - Intronic
1129304538 15:74649784-74649806 AGTTGCTACAATGAGGGATAGGG - Intronic
1132529238 16:436978-437000 AATAGCTAGAAGGAGGAGTCGGG + Intronic
1133334839 16:5000435-5000457 AAGTGTTACAATGAGGATAAGGG - Intronic
1133852482 16:9518496-9518518 AATTGCTGCAAGGATTAATAGGG - Intergenic
1134299918 16:12981542-12981564 AATTCCTTCAAGGTTGATTATGG + Intronic
1134399503 16:13896361-13896383 CATTGCATCAAGGAGGATGAAGG + Intergenic
1134904595 16:17969505-17969527 TTTTTCTGCAAGGAGGATTAGGG - Intergenic
1138199358 16:55077614-55077636 AAATGGGACAAGGAGGATGAAGG + Intergenic
1139942642 16:70617023-70617045 GGTTGCTTCAAGCAGGATTAGGG + Intronic
1142888492 17:2928235-2928257 AATTGCAACAAGAAAGATTCCGG - Intronic
1144054002 17:11522605-11522627 AATAGCTACATGGAGAATAAAGG - Intronic
1144360415 17:14486794-14486816 AGGTGCTATAAGGAGAATTAAGG + Intergenic
1144363667 17:14521090-14521112 AGCTGCTACAAGGAAAATTAAGG + Intergenic
1146495050 17:33314205-33314227 AAAGGCTGCAGGGAGGATTAAGG + Intronic
1150258015 17:63764522-63764544 AAGTGCTACAATGATGAATAGGG + Intronic
1152173067 17:78766513-78766535 AAATGCTACCCGGGGGATTAAGG + Intronic
1153840193 18:9000411-9000433 AAATCCTCCAAGGAGGACTAGGG + Intergenic
1158409418 18:57191958-57191980 AATTGCCATAAGGAGAAATATGG - Intergenic
1158634435 18:59144278-59144300 AATTCCTAGAAGTAGGATTATGG + Intronic
1160000028 18:75009011-75009033 AAATGCTGTAAGGAGGATAATGG - Intronic
1160233900 18:77070315-77070337 AATTGCTACAAATAGTATGAAGG - Intronic
927296498 2:21460501-21460523 AATTGCTACAATGACCATGAGGG - Intergenic
930921219 2:56756374-56756396 AATTTCTACAGGGAGTATGATGG + Intergenic
933195491 2:79384744-79384766 AATTTTGACAAGGAGGAGTAAGG - Intronic
938165098 2:129019209-129019231 AATTGATAAAAGGAGGAAAAAGG + Intergenic
939549202 2:143592628-143592650 ATTTGCTCAAAGGAGGATTAAGG - Intronic
939917478 2:148065098-148065120 ACTTTCTAAAAGGAAGATTAGGG + Intronic
940683950 2:156822679-156822701 AAATGCTGCAAGGAAGATTCTGG + Intergenic
942167400 2:173255194-173255216 AGTTGCTGCAGGGAGGATGATGG + Intronic
942922221 2:181389243-181389265 AATTGCTTCAAAGAGTATTTGGG - Intergenic
943983151 2:194581840-194581862 AATTGATACATGGATAATTATGG + Intergenic
944667821 2:201971664-201971686 AATAGCTACCAGGAGGCTTGTGG - Intergenic
945057190 2:205879319-205879341 AATTTATAAAAGGAGGTTTATGG - Intergenic
1169777229 20:9268900-9268922 AAATGCAACAATGAGGATAAGGG - Intronic
1172136846 20:32692333-32692355 GAGTGCTACAAAGAGGATCATGG - Intergenic
1172387172 20:34542195-34542217 AATTTCTCCAAGAAGGATAATGG + Intergenic
1173625562 20:44470115-44470137 CATTGCTACAAGATTGATTATGG + Intergenic
1173846528 20:46192072-46192094 AAATGCTACAAAGAGGAATAAGG - Intronic
1178112269 21:29380510-29380532 AATTTCTAGAATGAGGATTCTGG - Intronic
1179387969 21:40960114-40960136 GACTGCTTCAAGCAGGATTAGGG - Intergenic
952298524 3:32083496-32083518 AAGTGCTGCAAGGAGGGCTAGGG + Intergenic
953207859 3:40847950-40847972 TCTAGCTACAAGGAGGAGTAGGG - Intergenic
953233215 3:41083062-41083084 AAGTGGTACAAGGAGGAATGAGG + Intergenic
954223771 3:49170142-49170164 AAGTGGGACAAGGAGGATTGAGG + Intergenic
956354010 3:68370609-68370631 AAATGTTACAAGTAGGATGATGG + Intronic
958094344 3:88923074-88923096 AATTGCTGCAAAGAGGATGGGGG - Intergenic
958970446 3:100605392-100605414 ACTGGCTACAAAGAGGATGACGG - Intergenic
962398965 3:135040874-135040896 AATTGTTATCAGGAGGATTCAGG - Intronic
963722772 3:148882623-148882645 AATTGCTATAAGGAATATTTAGG + Intronic
965067179 3:163864569-163864591 AAGTCCTTCAAGGAGGATAAGGG + Intergenic
967725258 3:192856404-192856426 GATTGCTATAAGGAGAAATAAGG + Intronic
970415456 4:15852376-15852398 AATTGTTCTAAGGAGGAATAAGG - Exonic
971555109 4:28003605-28003627 AATTACTGGAAGGAGGCTTAAGG + Intergenic
972297541 4:37754542-37754564 AATGGCTGCAAGGAGGAAGAAGG - Intergenic
974148409 4:57974421-57974443 AAATGCTAAAAGTAGGATTCTGG + Intergenic
974773274 4:66444146-66444168 TATAGTTACAATGAGGATTAGGG + Intergenic
976233897 4:82875042-82875064 AACTGCTGCAAGGTAGATTATGG + Intronic
978787915 4:112630549-112630571 AATTGCTAGACTGAGGAGTAGGG + Intronic
987506625 5:18782670-18782692 AATAGCTACAAGGGGGTGTAGGG - Intergenic
988946849 5:36212150-36212172 AATTGCTTCAAGAAGAATTAAGG - Intronic
993514801 5:88818074-88818096 AATAGCTAGAAGGAGGATATTGG + Intronic
994018864 5:95001274-95001296 AATTGGTACCAGGAGGAGTGGGG + Intronic
995647850 5:114332934-114332956 AATTTCTCCAAGGAGGAATTAGG - Intergenic
996185450 5:120467937-120467959 AATTGCTACCAAGATGAATAAGG + Intronic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
998576033 5:143317679-143317701 AATTGCTACAAGGAGGATTATGG + Intronic
1000268693 5:159662160-159662182 AATTGCTACACTGAGAATAAAGG - Intergenic
1008930013 6:56929201-56929223 AATTCCCAGAAGGAGAATTATGG - Intronic
1009289030 6:61861362-61861384 AATTGTCTCAAGGTGGATTAAGG - Intronic
1009613473 6:65975979-65976001 AATTAATTCAAGGTGGATTAAGG + Intergenic
1011481922 6:87802923-87802945 AATTAATATAAGGAGGATTCTGG - Intergenic
1011686323 6:89826854-89826876 TATTGCTTAAAGGAGGAATATGG - Intergenic
1012430637 6:99160433-99160455 ACTTGCTTCAGGGAGGTTTATGG - Intergenic
1014079622 6:117271138-117271160 AAGGTCTCCAAGGAGGATTAAGG - Intronic
1015731963 6:136358082-136358104 AACTGCTAAAAGGAGGCTTGAGG - Intronic
1020532303 7:9353967-9353989 GACTGCTTCAAGCAGGATTAGGG + Intergenic
1020701067 7:11484123-11484145 AATAGCTCCACAGAGGATTAAGG - Intronic
1021731840 7:23603242-23603264 AGTTGCTACAAGAAGGATTTCGG - Intronic
1022038172 7:26553848-26553870 AATTTCTGCAAGGAGCTTTAGGG - Intergenic
1024838630 7:53556400-53556422 AAGTTCTACATGGAGGAATAAGG + Intergenic
1024978496 7:55135180-55135202 AATGGCTAGAAGGAGAATCATGG + Intronic
1027661739 7:80996083-80996105 AATGGCAACAAGGAGGAGGATGG + Intergenic
1030120070 7:106101390-106101412 AATTACTATAATGTGGATTATGG - Intronic
1030925426 7:115447631-115447653 AATTGTTCCAAGGAGCATAAAGG - Intergenic
1031526056 7:122822417-122822439 GGTTGCTTCAAGCAGGATTAGGG - Intronic
1032427047 7:131830695-131830717 AAGAGCTACAAGGAGGTTGATGG - Intergenic
1033622898 7:143077977-143077999 AGTTGTTTCCAGGAGGATTATGG - Intergenic
1037605072 8:20431344-20431366 AAATGCTACAAGATGGATTAGGG + Intergenic
1038941384 8:32309566-32309588 AAGAGCTAAAAGGAGGATTGGGG + Intronic
1044494788 8:92863972-92863994 AATGGCTATAGGGAGGAGTATGG + Intergenic
1046555700 8:115769824-115769846 AATGGCTACAAGAAGCATTTTGG - Intronic
1049722161 8:144123509-144123531 AATAGCTAGAAGGAGGATATTGG + Intergenic
1049869789 8:144965686-144965708 AGTTGTTCCCAGGAGGATTATGG + Intergenic
1050064654 9:1746495-1746517 AATTGTTACAATGAGAATAATGG - Intergenic
1055901292 9:81241356-81241378 TATTGAGACAAGGAGGTTTATGG - Intergenic
1057447969 9:95131879-95131901 AATTGCTACCTGGAGAATGAGGG + Intronic
1203741877 Un_GL000218v1:10585-10607 AATTGCAACAAGAAGAATTGAGG - Intergenic
1187799468 X:23044592-23044614 AATTGGTAAAAGGAGGTTTCAGG - Intergenic
1188196990 X:27247996-27248018 AATTGCCAGAATGAGGATAATGG - Intergenic
1188236632 X:27739739-27739761 ATTTACTACAGTGAGGATTAGGG - Intronic
1193554985 X:82942536-82942558 AATCTCTACAATGAGAATTATGG - Intergenic
1193645960 X:84068820-84068842 AATTGCTATAAAGAGAATAAAGG + Intronic