ID: 998576421

View in Genome Browser
Species Human (GRCh38)
Location 5:143322693-143322715
Sequence ATTCATATCAATATAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998576418_998576421 29 Left 998576418 5:143322641-143322663 CCTAAAAAGACATTTATAAAAAC 0: 1
1: 0
2: 12
3: 132
4: 1332
Right 998576421 5:143322693-143322715 ATTCATATCAATATAAAGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998576421 Original CRISPR ATTCATATCAATATAAAGGA AGG Intronic
906560634 1:46754303-46754325 ATTCTTATCTATATAATGAAAGG + Intergenic
907605990 1:55817961-55817983 ATACATGTCCACATAAAGGAAGG + Intergenic
907958446 1:59254405-59254427 ATTCCAATCAATAGAAAAGACGG + Intergenic
907997771 1:59650286-59650308 ATTCCAATCAATAGAAAAGACGG - Intronic
908709475 1:66998792-66998814 ATTCATAGAAACATAAAGAATGG + Intergenic
909839244 1:80297715-80297737 CTTAATATTAATATAAATGAGGG + Intergenic
909872634 1:80762434-80762456 GTTTATATCTATATAAAGAAAGG - Intergenic
911546803 1:99226939-99226961 ATTCATATAAATATCAAACAAGG - Intergenic
911591357 1:99751795-99751817 ATTCAGATCTACATAAAGAAAGG + Intronic
912370089 1:109167186-109167208 ATTCCTACCCATGTAAAGGAAGG + Intronic
913013160 1:114705191-114705213 ATTCACAGCAGTTTAAAGGATGG + Exonic
913197005 1:116465510-116465532 ATTCTTATCAATAAAAAAAATGG - Intergenic
914786325 1:150835290-150835312 AATCATAAAAACATAAAGGAGGG + Intronic
915057078 1:153142998-153143020 ATTCCAATCAATAGAAAAGAGGG - Intergenic
915751820 1:158218340-158218362 ATTCCAATCAATAGAAAAGAGGG - Intergenic
918351613 1:183661663-183661685 ATTCCAATCAATAGAAAAGAGGG + Intronic
918446194 1:184619270-184619292 ATTCTTACCAACATAAAGTAAGG + Intronic
918757985 1:188361001-188361023 ATTCATATAAATACAATGAATGG - Intergenic
919308063 1:195869966-195869988 AGTCATATAAAGATCAAGGAGGG + Intergenic
921321982 1:213950646-213950668 ATTCAAGTCAATAGAAAAGAAGG + Intergenic
921972459 1:221165148-221165170 CTTCATACCAAAATGAAGGAAGG + Intergenic
923422720 1:233834763-233834785 ATTCATATAAATATATATAATGG - Intergenic
924322242 1:242861925-242861947 ATGCATAGGAATGTAAAGGATGG + Intergenic
1063835646 10:10008422-10008444 ATTCACATCAATGCTAAGGATGG + Intergenic
1064500514 10:15967086-15967108 ATGCACATCAATATAAAGTTTGG - Intergenic
1066129328 10:32376122-32376144 AGTCATATAAATATATATGAAGG + Intronic
1066498563 10:35966864-35966886 ACTCAGATCTACATAAAGGAAGG + Intergenic
1072048051 10:91676702-91676724 ATTCAAATCAAAAGAAATGATGG + Intergenic
1072309924 10:94145062-94145084 ATTCTCATCAAAATAAAGTAGGG + Intronic
1072406845 10:95162848-95162870 ATTCCAATCAATAGAAAAGAGGG - Intergenic
1073549734 10:104386839-104386861 TTTCACATGAATTTAAAGGAAGG - Intronic
1074591639 10:114819605-114819627 ATTAATATCAATATTTAGGATGG - Intergenic
1074753013 10:116605255-116605277 ATTAATTTCCAAATAAAGGATGG - Intronic
1077245976 11:1538625-1538647 ATTCTTTTCAAAGTAAAGGATGG - Intergenic
1080368422 11:31607017-31607039 ATTCGTATCTTTATAAAAGAGGG + Intronic
1080909794 11:36584083-36584105 ATGCATATAAATCTAAATGATGG + Intronic
1082859490 11:57840906-57840928 ATGCCTATAAATATATAGGAGGG - Intergenic
1085482964 11:76837945-76837967 ATTCATATCCATATGGGGGATGG - Intergenic
1085962499 11:81478841-81478863 ATTGATATCACAATAAAGGGAGG + Intergenic
1086101010 11:83100033-83100055 ATCCAGAGCAATAAAAAGGAGGG - Intergenic
1086316506 11:85600163-85600185 ATTCATAGTAATATAAGGGAAGG - Intronic
1086333340 11:85775779-85775801 TTTCATATCAATAAAAGGGTGGG - Intronic
1086425083 11:86674930-86674952 ATTCATATCAAGCTACAGGGAGG + Intergenic
1087460016 11:98434129-98434151 ACTGATGTCCATATAAAGGAAGG - Intergenic
1087822328 11:102726514-102726536 ATTTATATTAATACAAAGAATGG - Intronic
1088901655 11:114122519-114122541 TTTAATATCATAATAAAGGAAGG + Intronic
1089473223 11:118737563-118737585 ATTTGTATCTATATAAAGAAAGG - Intergenic
1090126571 11:124092543-124092565 ATATATATATATATAAAGGAAGG - Intergenic
1090198139 11:124834726-124834748 ATTAATATGCATATAAGGGAAGG - Intergenic
1090680897 11:129056594-129056616 GTTCACAGCAATATTAAGGAAGG + Intronic
1090739724 11:129646695-129646717 ATTCAGATCTACATAAAGAAAGG + Intergenic
1090758806 11:129817186-129817208 ACTCATTTTAATAGAAAGGATGG + Intronic
1091883301 12:3997375-3997397 ATTCCTAGAAATAGAAAGGATGG - Intergenic
1093290469 12:17314332-17314354 ATTCAATTGTATATAAAGGAAGG + Intergenic
1093900129 12:24622361-24622383 ATTCCAATCAATAGAAAAGAGGG - Intergenic
1094261179 12:28501742-28501764 ATTCCAATCAATAGAAAAGAGGG - Intronic
1094574906 12:31676273-31676295 ATTCATATCAAAATACAAGCTGG + Intronic
1094804830 12:34079602-34079624 ATTCATAGCAATATGAAAAATGG - Intergenic
1095371901 12:41477684-41477706 ATGAATATAAATATAAATGATGG + Intronic
1097539768 12:60926072-60926094 ATCTATATCAATATGAAGAAAGG + Intergenic
1097641530 12:62189470-62189492 ATTCAAAACAAAATAAAGTAAGG + Intronic
1099253076 12:80282493-80282515 AGTCATATAATTATAACGGATGG + Intronic
1099463680 12:82955960-82955982 ATTCACATTAATATATAGCATGG + Intronic
1099488965 12:83264442-83264464 ACTCATATGACTATAGAGGAAGG + Intergenic
1099808345 12:87548143-87548165 ATTCATATTCAAATAAAAGAAGG + Intergenic
1100041682 12:90327121-90327143 GTTCATATCAAAAACAAGGAAGG + Intergenic
1100108578 12:91208818-91208840 ATTAATATACATATGAAGGAAGG - Intergenic
1101185066 12:102267495-102267517 ATACATATAAATTTAAAGTATGG + Intergenic
1101864212 12:108508107-108508129 ATTCTTATCTATTTAAAAGAGGG + Intergenic
1105574019 13:21632928-21632950 GGTCATATAAATATAAAGGAAGG + Intergenic
1106390065 13:29326533-29326555 AATTCAATCAATATAAAGGAAGG + Intronic
1106703555 13:32256053-32256075 GTTTCTATCAAAATAAAGGAAGG + Intronic
1108617616 13:52149546-52149568 ATTCAGATAGATATAGAGGAGGG - Intronic
1108899617 13:55384682-55384704 ATTGATAGAAATATAAGGGAAGG + Intergenic
1108915064 13:55598444-55598466 AATAATATGAATATGAAGGATGG - Intergenic
1109389907 13:61680059-61680081 ATTTATGTCAACATAAAGGTGGG - Intergenic
1109478916 13:62921274-62921296 ACTCATATAAATATATAGTATGG - Intergenic
1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG + Intergenic
1110100919 13:71600537-71600559 ATTTATATAATTATAAAAGAAGG + Intronic
1110196554 13:72795267-72795289 ATTTATATCAACATAAAGTTAGG - Intronic
1110360366 13:74617742-74617764 ACTCAGATCTACATAAAGGAAGG + Intergenic
1110425906 13:75366408-75366430 ATTAATGCCAATATAAAGGCAGG + Intronic
1110854420 13:80280342-80280364 ATTTTTAACAATATAAAGTATGG + Intergenic
1110949087 13:81462113-81462135 ATTCCAATCAATAGAAAAGAAGG - Intergenic
1111059820 13:83001593-83001615 ATACATATGCATATAAAGAAGGG - Intergenic
1111104249 13:83625073-83625095 ATTCTTATCAAAAGATAGGAAGG + Intergenic
1111544303 13:89710399-89710421 ATTCACATCAATACTCAGGAAGG - Intergenic
1111802759 13:92999748-92999770 CTTCATAGCAATGCAAAGGAAGG + Intergenic
1111989962 13:95106700-95106722 TTTTATATTAAGATAAAGGAGGG + Intronic
1112274199 13:98001176-98001198 ATTCATAGAAATAAAAAGGAAGG - Intronic
1114126628 14:19734483-19734505 AATCACAACAATAGAAAGGAGGG + Intronic
1114609424 14:24028172-24028194 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1115104165 14:29739829-29739851 ATTCAAATTAAAATAAAAGAAGG - Intronic
1115110952 14:29821282-29821304 AAAGATATCAATCTAAAGGAAGG + Intronic
1115425190 14:33250624-33250646 ATTCAAATAAATATAACTGATGG - Intronic
1116460128 14:45162742-45162764 ATTAATATCAATCTTAAGCATGG + Intronic
1116748817 14:48855535-48855557 ATTCATATAAATATTAAGTAAGG - Intergenic
1116988629 14:51248863-51248885 ATTAATTTCAATAAAAAAGAGGG + Intronic
1117545688 14:56793461-56793483 ATTCTTATCAATACATATGAAGG + Intergenic
1117585746 14:57201582-57201604 ATATATATATATATAAAGGATGG + Exonic
1118482057 14:66177105-66177127 ATTCATATCAAGAGAGATGAAGG + Intergenic
1118553266 14:66981290-66981312 ATTAAGATAAGTATAAAGGAAGG - Intronic
1119490910 14:75032230-75032252 ATTCAGATAAAAATAAAGCACGG + Intronic
1120289016 14:82543190-82543212 ATTCAGGTCAAAATGAAGGAAGG - Intergenic
1120782740 14:88500484-88500506 ATTCATATCAAAGCAAAGAATGG + Intronic
1121760047 14:96436988-96437010 ACTCATATCAATAATAAAGATGG + Intronic
1123777308 15:23592332-23592354 ATTTATATAAATATAACTGAAGG + Intronic
1123877299 15:24636467-24636489 ATTCCAATCAATAGAAAAGAGGG - Intergenic
1124169839 15:27362974-27362996 ATTTATATCAATTTACAGTATGG - Intronic
1124852238 15:33351365-33351387 ATTCCAATCAATAGAAAAGAGGG + Intronic
1124920812 15:34024550-34024572 ATTACTATAAATAAAAAGGAAGG + Intronic
1125135776 15:36341141-36341163 ATTCAGATCTACATAAAGAAAGG - Intergenic
1127057464 15:55146769-55146791 ATTCCAATCAATAGAAAAGAGGG + Intergenic
1127197342 15:56603119-56603141 AATCATGTCAAAACAAAGGAAGG - Intergenic
1127301815 15:57662525-57662547 TTTCTTATCATTATAAAGGAGGG + Intronic
1128360437 15:66957903-66957925 AATAATAAAAATATAAAGGAAGG - Intergenic
1128822082 15:70666212-70666234 ATTCAACTCAGTAGAAAGGAGGG + Intronic
1129593735 15:76942338-76942360 ATACATATCAGTTTATAGGAAGG + Intronic
1129854799 15:78815659-78815681 ATTTATATCAAGATACAGGGGGG - Intronic
1130135754 15:81180511-81180533 ATTCATATCATTATGAACCATGG + Intronic
1130513508 15:84608041-84608063 ATTCATATAAACAGAAAAGAAGG - Intronic
1130956962 15:88633907-88633929 ATTCAAATAAATTGAAAGGAGGG - Intergenic
1132022824 15:98378366-98378388 ATCCATATCTACATAAAGAATGG + Intergenic
1132441464 15:101869592-101869614 ATCCATATAAAAATAATGGACGG - Intergenic
1135273392 16:21087972-21087994 GTTCTTAGCAAAATAAAGGAAGG - Intronic
1135942359 16:26833466-26833488 ACTCATATTTATATAAAGAAAGG + Intergenic
1136917059 16:34215374-34215396 ATTCCAATCAATAGAAAAGAGGG - Intergenic
1137897353 16:52228512-52228534 ATTCTTGTCAATCCAAAGGATGG - Intergenic
1139116083 16:63954810-63954832 ATTCAGATCAATTTAAAGGGTGG - Intergenic
1141794418 16:86260624-86260646 ATTGATATCCAGAAAAAGGATGG - Intergenic
1143499813 17:7332073-7332095 ATTCTTCTCTATTTAAAGGAGGG + Intergenic
1144255941 17:13467179-13467201 CTTCATATATATATATAGGAAGG - Intergenic
1144973387 17:19126071-19126093 GTCCATATTAATATAAATGAAGG + Intergenic
1146067439 17:29647528-29647550 GTTGATATAATTATAAAGGATGG - Intronic
1147170943 17:38618492-38618514 TTCCACATCAATAGAAAGGAGGG - Intergenic
1149145386 17:53485355-53485377 ATTCTTATCTGTATAAAGCAAGG + Intergenic
1153358457 18:4165028-4165050 ATTCATATCCTTAAAAAGAATGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153558089 18:6338504-6338526 TTTCATATAATTATAAAGAAAGG + Intronic
1153749577 18:8214951-8214973 ATTTAAATCATTATCAAGGATGG - Intronic
1154019810 18:10653557-10653579 ATTCCAATCAATAGAAAAGAGGG + Intergenic
1154061077 18:11060862-11060884 ATTCCAATCAATAGAAAAGAGGG + Intronic
1155629021 18:27869588-27869610 ATTCATATGAATCTGAATGAGGG + Intergenic
1155721784 18:29022745-29022767 ATACATTTTAATATGAAGGAAGG - Intergenic
1155895465 18:31319951-31319973 ATTAATTTCAATATAAAATAAGG - Intronic
1157127348 18:44969514-44969536 ATTCTTATGCAAATAAAGGAGGG + Intronic
1157919817 18:51703141-51703163 ATTCCAATCAATATAAAAAAAGG - Intergenic
1158238103 18:55342362-55342384 ATTCATATTAAGATACATGAGGG + Intronic
1159190757 18:65038908-65038930 ATTCATATTAATTTATAGAAGGG + Intergenic
1159236097 18:65674242-65674264 ATTTATATAAATAAATAGGATGG - Intergenic
1159295354 18:66479355-66479377 AATAATATTAATATAAAGAATGG - Intergenic
1159438320 18:68446327-68446349 ATAGATGTCTATATAAAGGAGGG - Intergenic
1159733906 18:72069758-72069780 AATCAGCTCAATATAAAAGAAGG - Intergenic
1159792286 18:72797402-72797424 ATTAATATCACAATAATGGATGG + Intronic
1164148655 19:22529708-22529730 ATTCATACCAAGTCAAAGGAAGG + Intronic
1164347386 19:27283087-27283109 ATTCCAATCAATAGAAAAGAGGG - Intergenic
1165259950 19:34604600-34604622 CTTCATATCTATAGAAAGTAAGG - Intronic
1165916300 19:39263067-39263089 GTTATTATCAATAGAAAGGAAGG - Intergenic
1166237413 19:41466561-41466583 ATTGATCCTAATATAAAGGAAGG - Intergenic
925660060 2:6192942-6192964 ATTCTTATGAATATATATGATGG - Intergenic
925679432 2:6402986-6403008 ATTCTTAGCAATATATAGTATGG + Intergenic
926494851 2:13573454-13573476 TTGCATTTCAATAAAAAGGAAGG - Intergenic
926531246 2:14048855-14048877 ATACATATAAATACAAAGGAGGG + Intergenic
927583814 2:24280743-24280765 ATAGATAACAATAAAAAGGAAGG - Intronic
928188277 2:29136219-29136241 ATTGTTATTAATATAAAGAAAGG - Intronic
929039189 2:37726741-37726763 ATTCCAATCAATAGAAAAGAAGG + Intronic
929397060 2:41535120-41535142 CTTCATATCCAAATAACGGAAGG + Intergenic
930276704 2:49319575-49319597 ACTCAACTCAATATAAAAGAAGG - Intergenic
930600448 2:53436742-53436764 ATACATATTAAAATGAAGGATGG - Intergenic
930979735 2:57509150-57509172 ATTCACATGACTATAAAGGAAGG + Intergenic
931006734 2:57858356-57858378 ATTAATTTCAACATAAAGAATGG + Intergenic
931573429 2:63695115-63695137 ATTCATATCAATGAAAATAAGGG - Intronic
932092021 2:68814562-68814584 ATTTTTTTCAATATAAGGGAAGG + Intronic
932247695 2:70209395-70209417 ATTCATATGAATATGAATTATGG + Intronic
932266610 2:70372833-70372855 GTTCATATGATTATGAAGGATGG + Intergenic
933110148 2:78388223-78388245 TTACATATCAATAAAAAGAAAGG - Intergenic
933246103 2:79976407-79976429 TTACATCTCAATAAAAAGGAAGG - Intronic
933399451 2:81775326-81775348 ATTCAAATCTGCATAAAGGAAGG - Intergenic
933541953 2:83655752-83655774 ATGCACATCAATACAAAAGAAGG + Intergenic
933819177 2:86094272-86094294 ATTTATATCAACATAAAAGTAGG + Intronic
934831395 2:97529009-97529031 ATTCCAATCAATAGAAAAGAGGG + Intronic
935915890 2:107948850-107948872 AGTAATATGAATATAAATGAAGG + Intergenic
938835318 2:135096945-135096967 ATTTATATTAATATATAGAAAGG - Intronic
938944580 2:136200081-136200103 ATTACCAACAATATAAAGGAAGG - Intergenic
939054775 2:137351630-137351652 TTTCATGTAATTATAAAGGAAGG + Intronic
940923300 2:159334753-159334775 AAATATATCAATATAAAGGCAGG + Intronic
940963857 2:159815910-159815932 ATTCAGAACAATATGAAGGTTGG - Intronic
942706379 2:178777254-178777276 AAAAATGTCAATATAAAGGAAGG - Exonic
943089864 2:183361116-183361138 ATTTATACCAATCTGAAGGATGG - Intergenic
943348904 2:186773968-186773990 AATCATATCAATATATACCATGG + Intergenic
944299832 2:198110979-198111001 AATAATATCAATATTAAGGATGG - Intronic
944840735 2:203621358-203621380 ATTAATATCCTTATAAAAGAAGG + Intergenic
945883739 2:215353254-215353276 ATTCAAAACAATGTCAAGGAAGG - Intergenic
946728177 2:222682876-222682898 ATTCATATGAATATCAAGAGTGG + Intronic
947944326 2:234088035-234088057 ATTAATATCACAATAAAAGAAGG + Intergenic
1170003408 20:11640014-11640036 TTACATATCAATAAAAAAGAAGG + Intergenic
1170446188 20:16430471-16430493 ATTCATATTAATGTATAGCAGGG - Intronic
1170498393 20:16949292-16949314 TTTCAGATGAGTATAAAGGAGGG - Intergenic
1172023038 20:31928281-31928303 ATTTAAAACAATATAAAAGAAGG - Intronic
1174586311 20:51611063-51611085 ATTCATATAAAGCTGAAGGAAGG + Intronic
1174877330 20:54241618-54241640 ATTCCAATCAATAGAAAAGAGGG + Intergenic
1175474119 20:59257284-59257306 ATTCATGTTGATATAAAGTAAGG - Exonic
1177173743 21:17681820-17681842 GTTATTATCAATAGAAAGGAAGG + Intergenic
1180570801 22:16717337-16717359 ATTAACATAAATATAATGGAGGG - Intergenic
1181156012 22:20921502-20921524 AGTAAGATCAATATACAGGAGGG + Intronic
1181837594 22:25623682-25623704 ATTAATGTCAATAGAAAGGGAGG - Intronic
1182632754 22:31699973-31699995 ATTCATTCCAATATACAGAAAGG - Intronic
1183124432 22:35762247-35762269 ATTCCTATAAATATAAAAAAGGG - Intronic
949629179 3:5903949-5903971 ATTGTTATCAATTTAAAGCAGGG - Intergenic
950316417 3:12005018-12005040 TTTCAGACCAATAAAAAGGAGGG + Intronic
950333922 3:12178692-12178714 ATAAATATCAATCCAAAGGAAGG - Intronic
950581216 3:13863280-13863302 ATTCAATTCAATACAAAGTAAGG - Intronic
951005911 3:17615420-17615442 ATTCCAATCAATAGAAAAGAGGG - Intronic
951396394 3:22172768-22172790 ACTGATATAAATATAAATGAAGG + Intronic
951496597 3:23335336-23335358 ATTTAAATCTATAGAAAGGAAGG - Intronic
951699834 3:25484958-25484980 ATTAATATGACTATAAATGAAGG - Intronic
951909979 3:27739870-27739892 ATTCATATAATTATAAATAATGG - Intergenic
952117271 3:30197744-30197766 ACTCATATCACTATAAATGGTGG - Intergenic
952413878 3:33073195-33073217 ATTCAGAGCAATATCTAGGATGG - Intronic
953053617 3:39369172-39369194 ATTCCAATCAATAGAAAAGAAGG - Intergenic
955721043 3:61881703-61881725 CTTCATTTCTATATATAGGAGGG - Intronic
955807367 3:62751334-62751356 TTTCATATCAATAGAAATTAGGG - Intronic
955872618 3:63455549-63455571 ATTTGTATCACTATCAAGGATGG - Intronic
956265310 3:67389867-67389889 ATTCATATCAATATTAAAATTGG + Intronic
956338148 3:68188129-68188151 ATTCATTTCAAAAGCAAGGAAGG - Intronic
957019617 3:75110822-75110844 ATTCATATTAATATCATGAATGG - Intergenic
957107764 3:75912364-75912386 ATTAACATAAATATAATGGAGGG + Intronic
957420264 3:79958678-79958700 ATTAAAACCAATATAAAGTATGG + Intergenic
957671785 3:83314440-83314462 ACTAATATCATTATCAAGGAAGG + Intergenic
958561488 3:95753137-95753159 ATACATATCCATGTACAGGAAGG + Intergenic
958675842 3:97267420-97267442 TTTAAGATCAATAGAAAGGAAGG + Intronic
958975618 3:100665240-100665262 ATAAATATCAACATAATGGATGG - Intronic
959666935 3:108932965-108932987 ATTAATTTCAAAATAATGGAAGG + Intronic
959792355 3:110377929-110377951 ATTTATATAAATATAAAAAATGG - Intergenic
960277903 3:115747987-115748009 ATTCCAATCAATAGAAAAGAGGG + Intergenic
960536195 3:118816911-118816933 ATTCACATCCTTAAAAAGGAGGG + Intergenic
960689829 3:120334201-120334223 ATTCAAATAAATATAAAAGGTGG + Intronic
962669878 3:137694210-137694232 TTTCAAAGCAAAATAAAGGAGGG + Intergenic
963385737 3:144591287-144591309 ATTTATTTCAATAAAAAAGAAGG - Intergenic
963510939 3:146248152-146248174 ATAAACATCAATATTAAGGAAGG + Intronic
964289594 3:155162699-155162721 ATTCCTATCAAGAAAAAAGATGG - Intronic
965487168 3:169292595-169292617 ATTCAACTGAATATTAAGGAGGG + Intronic
966066148 3:175824605-175824627 ATTCATAGAAGTATAAAGCAGGG + Intergenic
966272632 3:178126236-178126258 ATTATTAGAAATATAAAGGAAGG + Intergenic
969788550 4:9476054-9476076 ATTAATATTAATATAAATAATGG - Intergenic
970202476 4:13623950-13623972 ATTCATATCAATATGATGAGTGG - Intronic
970509432 4:16766219-16766241 ATGTATATTAATATAAAAGATGG - Intronic
970814762 4:20141732-20141754 ATATAAATCAACATAAAGGAAGG + Intergenic
970877521 4:20889051-20889073 ATTCACAGCAATTTAAAGGATGG - Intronic
971092186 4:23358906-23358928 ATTAATATTAATATATAGCATGG + Intergenic
971458195 4:26864212-26864234 ATTCATAACATTATATAGTAAGG + Intronic
971594219 4:28508403-28508425 ATTCATATCAGTATAATTCATGG - Intergenic
971988639 4:33862553-33862575 ATTCATAGAAAAAAAAAGGATGG + Intergenic
972259682 4:37395745-37395767 TTTCAGGTCAATATAAGGGAAGG + Intronic
972317512 4:37941059-37941081 ATTCCAATCAATAGAAAAGAGGG - Intronic
972451859 4:39208731-39208753 AAACATATCAATGTAAATGATGG - Intronic
972685932 4:41353062-41353084 ATTCCAATCAATAGAAAAGAGGG + Intergenic
972789771 4:42360178-42360200 TTTCTTATCATTATAAATGATGG + Intergenic
972943001 4:44220103-44220125 ATTGGGATTAATATAAAGGAGGG - Intronic
972969949 4:44561711-44561733 ATTTATATCAATAAAAATGAAGG + Intergenic
973685195 4:53362891-53362913 TTTCTTTTCAATATGAAGGAAGG + Intronic
973736899 4:53880580-53880602 ATTCCAATCAATAGAAAAGAGGG + Intronic
973800016 4:54468410-54468432 ATTTATATCTACATAAAGAAAGG - Intergenic
974140028 4:57874409-57874431 TTTGTTATCAATATAAAGCAAGG - Intergenic
974219110 4:58943204-58943226 AGTAATATAAATATAAATGATGG + Intergenic
974320067 4:60335248-60335270 ATTCCTGTCAATATAATGGAAGG - Intergenic
974392516 4:61290633-61290655 GACCATCTCAATATAAAGGAAGG + Intronic
974656518 4:64830762-64830784 TTTCACAAGAATATAAAGGAAGG - Intergenic
974662974 4:64919163-64919185 CTTCCTTTCAACATAAAGGAGGG - Intergenic
974721930 4:65751514-65751536 ATTCATGTCATCATCAAGGAAGG + Intergenic
975196838 4:71535627-71535649 AATCATATCAATATTGAGGCAGG - Intronic
976676947 4:87713843-87713865 ATTCCAATCAATAGAAAAGAGGG + Intergenic
976888748 4:90018087-90018109 ACTCAGATCTATATAAAGAAAGG + Intergenic
976910404 4:90298029-90298051 ATTCCAATCAATAGAAAAGAGGG - Intronic
977094585 4:92724042-92724064 ATCTGTATCAATATACAGGAGGG + Intronic
977464099 4:97361564-97361586 ATTCTTATAAATAATAAGGAAGG - Intronic
977493222 4:97739819-97739841 ATTCCAATCAATAAAAAAGAGGG + Intronic
977661055 4:99586733-99586755 CTTAAAATAAATATAAAGGAAGG + Intronic
977967443 4:103169402-103169424 ATACATATCCACATATAGGAAGG + Intronic
978231419 4:106404986-106405008 ATTCCAATCAATAGAAAAGAGGG - Intergenic
980216371 4:129857355-129857377 ATTCCAATCAATAGAAAGAAAGG + Intergenic
980871395 4:138615405-138615427 ATTCATATCAAAATGAAGTCAGG - Intergenic
981259084 4:142698241-142698263 TTTCAAATCAATAAAAATGATGG - Intronic
981611261 4:146596367-146596389 CATTATATCAATATAAAGGAGGG - Intergenic
981631548 4:146824638-146824660 ATTCCAAACAATTTAAAGGAAGG - Intronic
981819686 4:148871681-148871703 ATTCATAGAAACAGAAAGGATGG + Intergenic
982107944 4:152027262-152027284 ATGCATATCAAAATCACGGAGGG + Intergenic
982498302 4:156119961-156119983 ATTCAGATCAACATAAATAAAGG + Intergenic
982529195 4:156517513-156517535 ATTCATTTCTAAAGAAAGGATGG - Intergenic
982576980 4:157125312-157125334 ATTCATGGCAATATAATGGTGGG + Intronic
982687900 4:158514050-158514072 GTTCAAATCAATGCAAAGGAAGG + Intronic
982883511 4:160749023-160749045 ATTCCAATCAATAGAAACGAGGG - Intergenic
982982657 4:162160245-162160267 ATTGATATTATTATAATGGATGG - Intronic
983475489 4:168207321-168207343 ATTTTTATCAAAAGAAAGGAAGG - Intergenic
984750472 4:183268075-183268097 TTTCATATCAATATTAATTATGG - Intronic
986895972 5:12368639-12368661 ATACATATCATTATGAAAGATGG - Intergenic
987795487 5:22622776-22622798 ATTCCGATCAATAGAAAAGAGGG + Intronic
989233221 5:39111872-39111894 ATTAATTGAAATATAAAGGAAGG - Intronic
990107186 5:52279009-52279031 ATTCCAATCAATAGAAAAGAGGG + Intergenic
990655063 5:57945888-57945910 ATTCCAATCAATAGAAAAGAGGG - Intergenic
990735172 5:58852595-58852617 ATCCATAGCAATTTAAAAGAGGG + Exonic
992796212 5:80256655-80256677 AAACATATCAATATTCAGGAAGG - Intergenic
993329344 5:86577762-86577784 ATTCATAATAATATAAAAGTAGG + Intergenic
993786301 5:92142122-92142144 ATTCAAATCAGTATAAATTATGG - Intergenic
994411444 5:99411269-99411291 ATTTTTATCAACATAAAAGAAGG + Intergenic
994468746 5:100174954-100174976 ATTTATATCAATCTTTAGGAGGG - Intergenic
994482384 5:100353978-100354000 ATTTTTATCAACATAAAAGAAGG - Intergenic
994915229 5:105967795-105967817 ACTCAGATCTATATAAAGAAAGG - Intergenic
995174299 5:109156852-109156874 AATCATATTAATATTATGGAGGG + Intronic
996304127 5:122026656-122026678 ATTTATAACAACATAAAGAAAGG - Intronic
997002164 5:129774560-129774582 TTTCATAACTATATAAAGGAAGG + Intergenic
997036600 5:130200386-130200408 CTTCAAATCAATATATATGAAGG - Intergenic
997245651 5:132346304-132346326 ATTCCTAGCAATAGAAAAGAGGG - Intergenic
997660748 5:135587835-135587857 AATCATATCAAAAGCAAGGAGGG + Intergenic
998576421 5:143322693-143322715 ATTCATATCAATATAAAGGAAGG + Intronic
998683516 5:144497773-144497795 ATTCCAATCAATAGAAAAGAGGG - Intergenic
998711081 5:144825881-144825903 ATTCCAATCAATAGAAAAGAGGG - Intergenic
998858325 5:146417573-146417595 ATTAAAATAAATATAAAAGAAGG - Intergenic
1000735753 5:164898078-164898100 GTTTATATCAATATAATGAAAGG - Intergenic
1000904530 5:166948374-166948396 AATGAAATGAATATAAAGGAGGG + Intergenic
1000925893 5:167193518-167193540 ATTCTTTTCAACATATAGGATGG + Intergenic
1202775712 5_GL000208v1_random:68751-68773 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1002949725 6:1797775-1797797 ATTCACATAAATACAAGGGAAGG + Intronic
1003049773 6:2768836-2768858 AATCTCATCAATAAAAAGGATGG - Exonic
1003106868 6:3223898-3223920 CTACATATCCATTTAAAGGAGGG + Intergenic
1003319868 6:5041594-5041616 ATTCACAGCAGTTTAAAGGATGG - Intergenic
1004067005 6:12256728-12256750 ATTAATAACAATATAATAGAAGG + Intergenic
1004347160 6:14859017-14859039 ATTCAAGGCAATATAAATGATGG + Intergenic
1004557697 6:16715673-16715695 ATTCATACCAACACAAAGCATGG - Intronic
1004577695 6:16913936-16913958 ATTCATTTAAATATAAAGAAGGG + Intergenic
1004602063 6:17159848-17159870 ATTCATCTTAATAAAAAAGAAGG + Intergenic
1005595899 6:27378953-27378975 ATTCATATGAATATAGAGAGAGG - Intronic
1006673555 6:35745747-35745769 AATCATTTCAAAATAAAGGCCGG + Intronic
1008077644 6:47162437-47162459 ATTGATGTCAATCTAAATGATGG - Intergenic
1008916669 6:56795139-56795161 ATTAATATCCTTAGAAAGGAGGG + Intronic
1009782399 6:68287501-68287523 ATTCCAATCAATAGAAAAGAGGG + Intergenic
1010336766 6:74694232-74694254 CTTCATATCTATATATATGAAGG + Intergenic
1012976825 6:105788792-105788814 ATTCATGTCCATAGACAGGAAGG - Intergenic
1013919465 6:115384542-115384564 ATGCATATCTTTATAAAGAAAGG - Intergenic
1014422670 6:121264520-121264542 ATTCCTAACAATTAAAAGGAAGG + Intronic
1014462444 6:121712991-121713013 ATTTATATCGATATATAGGTAGG - Intergenic
1014720124 6:124906517-124906539 ATTCAGATCAAAGGAAAGGAAGG - Intergenic
1015050399 6:128833055-128833077 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1016388756 6:143554131-143554153 ATTCATATCAATATCAACTTAGG + Intronic
1016577945 6:145591730-145591752 ATTCAGATCTATATAAAGAAAGG + Intronic
1016585225 6:145676884-145676906 ATTCCAATCAATATAAAAAAAGG + Intronic
1016839797 6:148514682-148514704 AGTCATTTCAATTTAAAAGATGG + Intronic
1017364880 6:153623860-153623882 ACTCATATCTATATAAAAAAAGG - Intergenic
1018363234 6:163094061-163094083 ATTCACACGAATATCAAGGAGGG - Intronic
1018546188 6:164938850-164938872 ACTCAGATCTATATAAAGAAAGG + Intergenic
1020404026 7:7811424-7811446 ATTCAGATGAAAATAAAGGTTGG - Intronic
1020625596 7:10575064-10575086 ATTCATGATAGTATAAAGGAGGG - Intergenic
1021272176 7:18603740-18603762 ACTCAGACCTATATAAAGGAAGG - Intronic
1022395025 7:29979919-29979941 TTTCATAGAAATATAAAGAAAGG + Intronic
1024190665 7:47004630-47004652 AATCAGATCTATATAAAGAAAGG + Intergenic
1024815235 7:53261420-53261442 GTTCATATGAACATAAAGAATGG + Intergenic
1024926569 7:54621122-54621144 ATTCATATGCATATAAAATATGG - Intergenic
1025518310 7:61683968-61683990 AAACATATCAATCAAAAGGAAGG + Intergenic
1025542636 7:62112615-62112637 AAACATATCAATCAAAAGGAAGG + Intergenic
1025575864 7:62640627-62640649 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1027376323 7:77554575-77554597 ATTCACATCTACATAAAGAAAGG - Intronic
1027981194 7:85224821-85224843 ATGCTTATCAGTATAAAGCAAGG - Intergenic
1028329459 7:89571341-89571363 ATTGATATCAATGTTATGGAGGG + Intergenic
1028789484 7:94836985-94837007 AATCAATTAAATATAAAGGAAGG - Intergenic
1028837073 7:95386587-95386609 ATTCCAATCAATAGAAAAGAAGG + Intronic
1029655871 7:101924081-101924103 ATCCTGATCAATAAAAAGGAGGG - Intronic
1029921091 7:104264911-104264933 ACTCAGATCTACATAAAGGAAGG - Intergenic
1030352091 7:108501004-108501026 TTTGACATCAATATGAAGGAAGG - Intronic
1030640078 7:111994946-111994968 ATTTATATCAATATCTAGTAGGG + Intronic
1030908788 7:115220534-115220556 TTTGGTAACAATATAAAGGAAGG + Intergenic
1032260874 7:130335903-130335925 ATTCAGATCTACATAAAGAAAGG + Intergenic
1032559736 7:132876302-132876324 ATTCTTATCAATAGCAAGAAAGG + Intronic
1032965178 7:137088418-137088440 AAAAAGATCAATATAAAGGAGGG + Intergenic
1034126170 7:148673671-148673693 ATTCATATTAATGTCAAAGAAGG - Intergenic
1034438824 7:151076446-151076468 ATTCACTTAAATAAAAAGGAGGG - Exonic
1035132223 7:156666086-156666108 AGTCTAATCAATAGAAAGGAGGG + Intronic
1037669657 8:21003284-21003306 ATTCACATCCAAAGAAAGGATGG - Intergenic
1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG + Intergenic
1038124036 8:24651287-24651309 ATTCATTTCCATTTAAAGTATGG + Intergenic
1039207061 8:35168760-35168782 TTTAATATCTATATAAAGGAAGG - Intergenic
1040273333 8:45982570-45982592 ATTCCAATCAATAAAAAAGAGGG - Intergenic
1040695856 8:49997479-49997501 ATTCATAGTGAAATAAAGGAGGG - Intronic
1041697459 8:60751270-60751292 ATGCATATTAATAAAAATGAAGG - Intronic
1041816842 8:61982821-61982843 ATTCATATTGATAGAAATGAAGG + Intergenic
1041947221 8:63459455-63459477 ATTGATATCAATGTACAGGAAGG - Intergenic
1042114164 8:65413499-65413521 ATCCATATGAATATAAAAGCTGG + Intergenic
1043549012 8:81347909-81347931 AATCAAATCAATATAAACAATGG + Intergenic
1043620788 8:82190421-82190443 AATTATATCAAAATAAAAGATGG - Intergenic
1043794483 8:84519333-84519355 ATTCATATTAAGAGAGAGGATGG - Intronic
1044038730 8:87338276-87338298 ACTCATATCTATATAATGAAAGG - Intronic
1044049819 8:87486641-87486663 ATTCCAATCAATAGAAAAGAGGG + Intronic
1044283094 8:90379026-90379048 ATTCCAATCAATAAAAAAGAGGG + Intergenic
1045767281 8:105689009-105689031 ATTCTCACCAATATGAAGGATGG - Intronic
1046298930 8:112259923-112259945 ATGCATATTCAAATAAAGGAGGG + Intronic
1048134258 8:131731233-131731255 ATTCAGATCTACATAAAGAAAGG + Intergenic
1050081938 9:1924684-1924706 AATCAAATAAATATAAAGTAAGG + Intergenic
1050374980 9:4961426-4961448 ATTCAGATCTACATAAAGAAAGG - Intergenic
1050808477 9:9714848-9714870 TTTCATATCAGGATAAAGGAAGG - Intronic
1051090472 9:13401661-13401683 AATCTTATCAATATATATGAAGG + Intergenic
1052168347 9:25362138-25362160 ACTCATGTCTATATAAAGAAAGG - Intergenic
1053340026 9:37317968-37317990 TTACAAATCAATATAAAGAAAGG + Intronic
1056876261 9:90334434-90334456 ATTCTGATCTATATAAAGGAAGG + Intergenic
1057860207 9:98634941-98634963 ATTTATGTCAGTATAAGGGAGGG - Intronic
1058035876 9:100252101-100252123 ATACATATGAATAGGAAGGAAGG + Intronic
1058097059 9:100874231-100874253 ATTCATATGAAAATATATGATGG - Intergenic
1058228430 9:102395534-102395556 ATTGATATCACTTTGAAGGAGGG - Intergenic
1058490311 9:105492034-105492056 ATTCCAATCAATAAAAAAGAAGG - Intronic
1059782090 9:117540600-117540622 ATACATATCACAATAAAGGTAGG + Intergenic
1060646234 9:125282641-125282663 ATTCTTATCAATTAAAAGGTAGG - Intronic
1186068651 X:5793685-5793707 ATTCATATGAATATATATGGGGG - Intergenic
1188091600 X:25971019-25971041 ATTCAAAACAATAAAGAGGAGGG + Intergenic
1189201243 X:39197429-39197451 ACAAATATCAATATAATGGAGGG + Intergenic
1190518897 X:51256333-51256355 ATTCATATCAACATGACTGAAGG + Intergenic
1191808423 X:65160297-65160319 ATTCCAATCAATACAAAAGAAGG - Intergenic
1192912523 X:75619982-75620004 ATTCCAATCAATAGAAAGAAAGG + Intergenic
1193477555 X:81985197-81985219 ATTCTGATCAATAAAAAAGAGGG + Intergenic
1193897982 X:87137400-87137422 ATTCATATCAACAGAATGAAGGG + Intergenic
1195056282 X:101148608-101148630 ATTGATATCAATATGCAGGCAGG + Intronic
1195821012 X:108945072-108945094 ATCAATATCCAAATAAAGGAAGG - Intergenic
1201058791 Y:10023053-10023075 ATTCTTAACAGTATAAAGCATGG - Intergenic
1201212768 Y:11695725-11695747 ATTTAAAGCAATATAATGGAAGG + Intergenic
1201453547 Y:14143078-14143100 ATTCACAGTTATATAAAGGATGG - Intergenic
1201899880 Y:19038093-19038115 ATTCCAATCAATAGAAAAGAGGG + Intergenic
1201925812 Y:19286439-19286461 ATTCCAATCAATAGAAAAGAGGG - Intergenic
1202079220 Y:21067206-21067228 ATTCCAATCAATAGAAAGGAGGG + Intergenic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic