ID: 998581305

View in Genome Browser
Species Human (GRCh38)
Location 5:143378989-143379011
Sequence TAGGATTCCCTGTGATTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998581305_998581308 -5 Left 998581305 5:143378989-143379011 CCCATGAATCACAGGGAATCCTA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 998581308 5:143379007-143379029 TCCTACCCCAAGGAGACTTTTGG 0: 1
1: 2
2: 11
3: 90
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998581305 Original CRISPR TAGGATTCCCTGTGATTCAT GGG (reversed) Intronic
907639646 1:56174478-56174500 TAGGAGTCCCTGTGAGCCTTTGG - Intergenic
909185196 1:72478778-72478800 GAGAATTTCCTGTGATTCAGGGG + Intergenic
910625135 1:89298466-89298488 TAAGATTACCTATCATTCATAGG - Intergenic
910728259 1:90361006-90361028 TTGGATTGCCTGTGATTCTAAGG - Intergenic
913564849 1:120062817-120062839 TAGGTTTCCATGTAATTCACTGG - Intronic
913633282 1:120730746-120730768 TAGGTTTCCATGTAATTCACTGG + Intergenic
914285434 1:146222167-146222189 TAGGTTTCCATGTAATTCACTGG - Intronic
914546465 1:148672922-148672944 TAGGTTTCCATGTAATTCACTGG - Intronic
914620100 1:149397748-149397770 TAGGTTTCCATGTAATTCACTGG + Intergenic
921656866 1:217749774-217749796 AAAGATTCCCTGTTATCCATAGG + Intronic
923282577 1:232458877-232458899 TAGCAGTACATGTGATTCATGGG + Intronic
1063880370 10:10525434-10525456 TTGGCTTCCCTGGGATGCATTGG - Intergenic
1064643291 10:17435616-17435638 TGGGAGTCCCTGTGATCTATGGG - Intronic
1064662461 10:17619130-17619152 TAGGATTCCTCGAGATTCCTGGG - Intergenic
1067848346 10:49739968-49739990 AGGGATTCCCTGGGATTCAAAGG + Intronic
1070399678 10:76042348-76042370 TAGAAATCTCTTTGATTCATTGG + Intronic
1074933937 10:118159178-118159200 TAGGGTTCCTTGTGGTTCACAGG + Intergenic
1078967123 11:16358816-16358838 TAGGATTGCCTTAGAGTCATAGG - Intronic
1081714913 11:45243122-45243144 TGGGATCTCCTGTGAGTCATTGG - Exonic
1081964851 11:47163272-47163294 TAGGCTTTCCTGTGATTCTGAGG - Intronic
1082671124 11:56037799-56037821 TAGGATTGCCTGGGCTACATGGG - Intergenic
1083012947 11:59421478-59421500 TAGGAGCCCCTGTGACTGATGGG - Intergenic
1083516964 11:63268889-63268911 TTGGATTTTCTGTGTTTCATGGG - Intronic
1083966100 11:66044893-66044915 CAGGATACCATGTGATTCATGGG - Intronic
1086766230 11:90698705-90698727 CAGTATAACCTGTGATTCATGGG - Intergenic
1087245838 11:95835742-95835764 GAAGATTCCCTGTTATTTATAGG + Intronic
1087527530 11:99335970-99335992 TAGGATTCTCTGTGTTTCCAGGG - Intronic
1090596260 11:128324180-128324202 AAGGATTCCTTGTGACTCAAAGG - Intergenic
1098663097 12:73124142-73124164 TAGGTTTCACTGTCTTTCATTGG - Intergenic
1101549185 12:105746312-105746334 TAGGATACCCTGAGTTTCACTGG - Intergenic
1102839954 12:116108302-116108324 TTGGCTTCCCTGTGTCTCATCGG + Intronic
1104213692 12:126714900-126714922 AAACATTCCCTGTGATTCAGTGG - Intergenic
1107753076 13:43589868-43589890 TAGACTTGCCTGTGCTTCATTGG - Intronic
1108480888 13:50870269-50870291 TAAGATTTCCTGTGATTAATTGG - Intergenic
1110680009 13:78298847-78298869 TTGGGTTCCCTGTGCTTCCTTGG + Intergenic
1112557172 13:100479222-100479244 TAGGCATCCCTGTGATGAATGGG - Intronic
1113250729 13:108449598-108449620 AAGGGTTCCCTGTGTTTCAAAGG + Intergenic
1113290428 13:108899923-108899945 CAAGATTCCAGGTGATTCATGGG + Intronic
1114998513 14:28391035-28391057 CAGGAATGCCTGTTATTCATGGG + Intergenic
1117068014 14:52029984-52030006 TATTATTTCCTGTGATTCTTGGG + Intronic
1119114570 14:72007639-72007661 TTGGCTTCCCTGAGATACATAGG - Intronic
1122894205 14:104747889-104747911 TAGGATTCCCTGTCTTTGAAAGG - Intergenic
1123510295 15:20992054-20992076 TAGCATGCCCTGTTATTCTTGGG + Intergenic
1123567512 15:21565804-21565826 TAGCATGCCCTGTTATTCTTGGG + Intergenic
1123603776 15:22003097-22003119 TAGCATGCCCTGTTATTCTTGGG + Intergenic
1126195407 15:45925422-45925444 CAGGATGCCCAGAGATTCATGGG - Intergenic
1127398671 15:58564203-58564225 TTGGCTTCCCAGTGATTCTTTGG - Intronic
1202975875 15_KI270727v1_random:292898-292920 TAGCATGCCCTGTTATTCTTGGG + Intergenic
1132919043 16:2373951-2373973 TAGGATTACCTGTGCGTGATGGG + Intergenic
1132952403 16:2570663-2570685 TAGGATTGGCTATGATGCATGGG + Intronic
1132961948 16:2629507-2629529 TAGGATTGGCTATGATGCATGGG - Intergenic
1133545061 16:6798215-6798237 TAGTATCCCCAGTGATTCTTAGG - Intronic
1133959959 16:10484801-10484823 TAGGATTCCTAGTGATTCCTTGG - Intergenic
1137418672 16:48311274-48311296 TAGGAATACCTATGATTCATAGG + Intronic
1141765382 16:86054951-86054973 TTGGTTTCCCTGTGATTATTCGG - Intergenic
1143441399 17:6977156-6977178 TAGGACACCCTGAGATTCACCGG + Intronic
1144560661 17:16318222-16318244 AAGGATTACCTGTGATTGGTGGG - Intronic
1150925335 17:69526587-69526609 TCGATTTCCCTATGATTCATGGG + Exonic
1158067042 18:53423124-53423146 TAGGAATTGATGTGATTCATGGG + Intronic
1159320451 18:66840431-66840453 TAGGAATGCCTATAATTCATAGG - Intergenic
1165686637 19:37827372-37827394 TAAGAATACCTGTGATTCATGGG + Intergenic
1166620307 19:44292614-44292636 CAGGAATACCTATGATTCATAGG - Intronic
1168380487 19:55916735-55916757 CAGGAATGCCTATGATTCATAGG - Intronic
926390156 2:12381766-12381788 AAGGACTCCCTGTCATTCATGGG - Intergenic
927894387 2:26772037-26772059 TAAGATTCCTTGTGGTTCTTGGG - Intronic
932534990 2:72583220-72583242 TAGGAATGCCAGTAATTCATAGG - Intronic
933076230 2:77930866-77930888 TTAGATTTCCTGTTATTCATTGG - Intergenic
933881627 2:86675528-86675550 TAAGATTGGCTGTGAATCATTGG + Intronic
937011094 2:118563472-118563494 TAGGATTCCCAGAAATTCAAGGG - Intergenic
940337051 2:152540293-152540315 TAGGATCCCCTCTGATTCCTTGG + Intronic
940690307 2:156909652-156909674 AGAGATTCCCTGTGATTTATTGG - Intergenic
941154894 2:161964472-161964494 TAGGAATCACTGAAATTCATAGG - Intronic
943276834 2:185877833-185877855 TAGGATTGCCTGTAACTCATAGG - Intergenic
944137208 2:196412832-196412854 AAGGATTTCATATGATTCATGGG - Intronic
944738283 2:202587945-202587967 TAGGAATACCTATGATTTATAGG + Intergenic
947397885 2:229704330-229704352 TAGGATTTCCTGGGATTGCTGGG - Intronic
1168736226 20:139538-139560 CAGGAATACCTGTGACTCATAGG - Intergenic
1173096888 20:40041923-40041945 TTGATTACCCTGTGATTCATGGG - Intergenic
1173540841 20:43849809-43849831 GAGGATCCCCTGTCATTCATGGG + Intergenic
1174012498 20:47461793-47461815 TGGGATGCCCTGTGCTTCTTTGG - Intergenic
1178185181 21:30210122-30210144 AAGTCTTCCCTGTGATTCACTGG - Intergenic
1179395321 21:41034599-41034621 TAAGAACACCTGTGATTCATGGG - Intergenic
1180620764 22:17160095-17160117 TAGGATGCCCTCAGATTCTTTGG + Intronic
1184774069 22:46614809-46614831 TAGGTTCCCCTGTGCTTTATAGG + Intronic
952178237 3:30890551-30890573 TAAGAGTCCAGGTGATTCATAGG - Intronic
953847096 3:46436294-46436316 TAGTATTCTCTTTGATTTATTGG - Intronic
954683054 3:52356212-52356234 CAGGATTCTCTGAGATTCAATGG - Intronic
958089664 3:88860416-88860438 TAGGATTCCATCTGATTCTCTGG - Intergenic
963251300 3:143105612-143105634 AAGGAGTCCCAGTGATTCAGGGG - Intergenic
963816086 3:149832434-149832456 TAGGATTTACTGTGATGCTTGGG + Intronic
966236152 3:177704052-177704074 TAGGAAGTGCTGTGATTCATGGG - Intergenic
966332857 3:178834543-178834565 TAGAATTATCTGTGATCCATAGG + Intronic
967441027 3:189509211-189509233 TAGGGTTCTCTTTGATTTATAGG + Intergenic
970849614 4:20585469-20585491 TAGGATTTCCTGGGATTTAGAGG + Intronic
971125429 4:23748683-23748705 AAGGATTCCATGAGATTCTTTGG + Intergenic
971296446 4:25397625-25397647 TAGGATTCCCTGAGGGTTATTGG + Intronic
974295477 4:59993812-59993834 TAGCAGTCCCTGTGATTCTGTGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974954774 4:68623984-68624006 TATTATTCCAGGTGATTCATGGG + Intronic
976698102 4:87939581-87939603 TTGGATTCCCTGAGTTTAATAGG + Intergenic
981267347 4:142802450-142802472 AAGGCTTCTCTGTGATTCTTTGG - Intronic
982021866 4:151212876-151212898 TAAGAATATCTGTGATTCATGGG + Intronic
983326055 4:166258334-166258356 TAGACTTCCGTGGGATTCATTGG + Intergenic
983416173 4:167458159-167458181 TAGAATTCTCTGAGATTCCTGGG + Intergenic
983831839 4:172337897-172337919 CAGGAATGCCAGTGATTCATAGG + Intronic
986257112 5:6109640-6109662 TGTGATTATCTGTGATTCATAGG - Intergenic
986652717 5:9980205-9980227 CAGCTTTCCCTGTGATTCAGGGG - Intergenic
987259678 5:16190526-16190548 TAGCTTTCCCTGTTATTCAGGGG - Intergenic
987266339 5:16259351-16259373 TCAAATTCCCTGGGATTCATTGG + Intergenic
989374934 5:40751052-40751074 TAGGAATATTTGTGATTCATGGG - Intronic
990962761 5:61412150-61412172 CTCAATTCCCTGTGATTCATTGG - Intronic
996514756 5:124357404-124357426 TAGGATACTCTCTGATTCAAGGG + Intergenic
998581305 5:143378989-143379011 TAGGATTCCCTGTGATTCATGGG - Intronic
999716864 5:154368063-154368085 AAGCCTTCCCTGTGATTCCTAGG - Intronic
1000839222 5:166195848-166195870 TAGTATTGTCTCTGATTCATAGG - Intergenic
1003985157 6:11427921-11427943 TAGTATTCCAAGTGAGTCATAGG - Intergenic
1004726109 6:18312705-18312727 TAGGATTCACTGTGATTCTTGGG + Intergenic
1005833980 6:29693655-29693677 TAGGAATACCTATGATTCATGGG + Intergenic
1009461207 6:63915652-63915674 TAAGAATACCTATGATTCATGGG + Intronic
1012864041 6:104596220-104596242 CAGGATTCCCTGTGGATCAGTGG + Intergenic
1016244165 6:141963176-141963198 TAGGTCTCTCTCTGATTCATAGG - Intergenic
1017284981 6:152664037-152664059 TTGCACTCCCTGTGATTCCTTGG + Intergenic
1021188326 7:17591520-17591542 CATCCTTCCCTGTGATTCATGGG - Intergenic
1021481789 7:21126048-21126070 AAGAATTCCCTGTGACTCAACGG + Intergenic
1021645176 7:22782574-22782596 TTTGATTCCCTGTGCTTCATAGG - Intergenic
1022772333 7:33487195-33487217 TAGGATTCATTGTAATTCGTTGG + Intronic
1026399131 7:69991371-69991393 TAGAATTAGCTGTGATCCATAGG + Intronic
1028058390 7:86277720-86277742 TAGGATTCCCAGTCCCTCATGGG + Intergenic
1029610169 7:101622529-101622551 TGGGATTCCCTGTGGTTCCAGGG + Intronic
1029823492 7:103166961-103166983 TAGGATGGGCTGTGATTCTTAGG - Intergenic
1032428569 7:131842052-131842074 CAGGATTCCCTCTTACTCATAGG - Intergenic
1035144510 7:156800766-156800788 TAAGAATATCTGTGATTCATGGG + Intronic
1035737870 8:1901788-1901810 TAGAATTCGTTGTGACTCATAGG + Intronic
1037216012 8:16451999-16452021 CAGACTTCCCTGTGATTCAGTGG + Intronic
1039512993 8:38106164-38106186 TAGGCTTCCCTGTGCTCCGTGGG + Intronic
1047515821 8:125554107-125554129 GAGAAATCCCCGTGATTCATAGG + Intergenic
1056572724 9:87829935-87829957 GATCATTCCCTGTGACTCATGGG - Intergenic
1057956850 9:99416562-99416584 TAGGGATCCATGTGATTCTTTGG - Intergenic
1058938685 9:109792824-109792846 TAGGATGCCCAGTGATTCCATGG + Intronic
1203745464 Un_GL000218v1:38630-38652 GAGGAATCCCTGTGCTTCAGAGG - Intergenic
1203564646 Un_KI270744v1:80854-80876 GAGGAATCCCTGTGCTTCAGAGG + Intergenic
1192830583 X:74747073-74747095 TATGATTCCATCTGATTTATAGG - Intronic
1195090280 X:101451757-101451779 TAGGATTTCCTTTCATTCTTTGG - Intronic
1197813775 X:130475801-130475823 TATGATTCTCTTTGATTCAAAGG + Intergenic
1198272043 X:135064246-135064268 TAGGATCCCCTGTATTTGATGGG - Intergenic
1199672026 X:150155530-150155552 TAGGATGGCCTCTGATTCATAGG - Intergenic