ID: 998585051

View in Genome Browser
Species Human (GRCh38)
Location 5:143418706-143418728
Sequence AAGGGTAAACAGTTGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998585046_998585051 2 Left 998585046 5:143418681-143418703 CCTGGAGGAGGCAGAATGAGACT 0: 1
1: 2
2: 2
3: 43
4: 360
Right 998585051 5:143418706-143418728 AAGGGTAAACAGTTGGTGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998585051 Original CRISPR AAGGGTAAACAGTTGGTGCT GGG Intronic
902100110 1:13981045-13981067 AAGGGGCAAAAGTTGGTTCTTGG + Intergenic
902195799 1:14797028-14797050 AAGGGCAGAAAGGTGGTGCTGGG + Intronic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
905575163 1:39038209-39038231 AATGGTCAACAAGTGGTGCTGGG + Intergenic
905843278 1:41204137-41204159 AAGGTTACACAGTTGGTACATGG + Intronic
906687525 1:47772095-47772117 AAGGGCAACCACATGGTGCTGGG + Intronic
906956207 1:50377011-50377033 TTGGGGAAACAGTTGGTGTTTGG - Intergenic
912620685 1:111153701-111153723 AAGGATAAATAAATGGTGCTAGG - Intronic
919850437 1:201668595-201668617 AAGGGTAGAGAGGTGGTGCTGGG + Intronic
921565677 1:216715287-216715309 GACTGTATACAGTTGGTGCTGGG - Intronic
921868575 1:220112433-220112455 AGGGGTAAAAAGTAGGTGGTCGG - Intronic
923351771 1:233114420-233114442 AACGGAGACCAGTTGGTGCTGGG + Intronic
923518021 1:234713740-234713762 AAGGGTCAAGAGTTGGTGGTTGG + Intergenic
924435782 1:244040634-244040656 AAGGGAAAACATTTCTTGCTTGG + Intergenic
1063621836 10:7656634-7656656 AAGTGTAAACTATTGTTGCTGGG + Intronic
1066723004 10:38359056-38359078 ATGTGTGATCAGTTGGTGCTGGG + Intergenic
1069055081 10:63836408-63836430 AAGGCTAAACCAGTGGTGCTTGG - Intergenic
1071705446 10:87993188-87993210 AAGGGATAAGAGTTGGGGCTTGG - Intergenic
1071766357 10:88670115-88670137 AAGGGGATACAGTTCGTGCAAGG + Intronic
1071809569 10:89164726-89164748 AAGGGAAAAGAGTTGGAGCAAGG + Intergenic
1073262191 10:102198955-102198977 AAGGGAAAAGAATTGGTACTTGG - Intergenic
1075756638 10:124817503-124817525 AAGGGTAAGAAGTTGGGTCTCGG - Intronic
1075819310 10:125292068-125292090 AAGAGTAAACAGATGGTCTTTGG - Intergenic
1077128666 11:957715-957737 CAGGGCAAACAGTTGTTGGTAGG - Intronic
1077438693 11:2558183-2558205 AAGCATCTACAGTTGGTGCTGGG - Intronic
1077971121 11:7192110-7192132 AAGTGTAAAGTGTTTGTGCTAGG + Intergenic
1081876599 11:46412681-46412703 AAGGATAAACAGTTGGCCCTTGG - Intronic
1085348534 11:75783592-75783614 ATGGGCACACAGTAGGTGCTTGG + Intronic
1085868663 11:80324758-80324780 AAGGGGAAGCATTTGGTGCAAGG - Intergenic
1089061673 11:115630932-115630954 ATGGGGAAACAGTAGCTGCTAGG - Intergenic
1089788935 11:120928561-120928583 AAGGGTAAATAGTATCTGCTTGG + Intronic
1090695344 11:129235578-129235600 AAGAGAAAACAGGTGGCGCTTGG + Intronic
1090899833 11:131019072-131019094 AAGGGTAATAAGGGGGTGCTGGG + Intergenic
1093128564 12:15360124-15360146 AAGGGTAAAAACGTGATGCTGGG - Intronic
1094004752 12:25737667-25737689 AAGGGTACAGAGATGGTGCCAGG - Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1103528592 12:121583969-121583991 AAGGACAAATAGTTGGTGATAGG - Intergenic
1106858207 13:33875524-33875546 AATGGTAAAGAGTTGAGGCTGGG + Intronic
1106879562 13:34114533-34114555 AAGGATAAAGAGTTGGTGTCTGG + Intergenic
1107784371 13:43940098-43940120 TAGGGTAACCCTTTGGTGCTTGG + Intergenic
1107851968 13:44579508-44579530 AAGGGTATACAGCTGCTGTTTGG - Intergenic
1108415739 13:50196633-50196655 AAGGTTAAACAGTTTGTAATTGG + Intronic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1109239201 13:59862883-59862905 AGGGATAAAAAGTTGGTTCTTGG - Intronic
1109692311 13:65909674-65909696 CAGAGTAAACAGATGATGCTTGG - Intergenic
1110616087 13:77543677-77543699 AAGGGGAAACACTTGGTATTTGG + Intronic
1112587994 13:100736756-100736778 AAAGGAAAACAATTGGTGTTTGG - Intergenic
1114846883 14:26333147-26333169 AAAGTTAAGCAGTTTGTGCTGGG - Intergenic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1117275909 14:54192973-54192995 ATGGGGAAGCAGTGGGTGCTTGG - Intergenic
1117761415 14:59032734-59032756 AAGGAAGAACAGTTGGAGCTGGG - Intergenic
1118790873 14:69091544-69091566 AAGGGGAAACAGTGAGTGCCTGG - Intronic
1119617521 14:76108469-76108491 AAGGGTAAGGAGTTGGAGCTGGG - Intergenic
1124985307 15:34603941-34603963 AAGTGAGAACATTTGGTGCTTGG + Intergenic
1140021087 16:71239564-71239586 AAGGGGCAAAAGTTGGTTCTTGG - Intergenic
1141135822 16:81464692-81464714 ATGGGTACAGAGTTTGTGCTGGG - Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1143099713 17:4498588-4498610 AAGGGTACTGAGTAGGTGCTGGG + Intergenic
1144458622 17:15439476-15439498 AAGGGTGAACAGTCTGTGCTTGG - Intronic
1149047340 17:52262558-52262580 TAGGGTAATCATTTGGTGTTAGG + Intergenic
1151170448 17:72241403-72241425 AAGGGTAAAAAGTAGGAGTTAGG + Intergenic
1152508817 17:80771577-80771599 CAGGGTAAACACCTGGGGCTGGG - Intronic
1153718498 18:7876475-7876497 ATGGGTCAGCAGTTGGGGCTGGG + Intronic
1155133695 18:22965764-22965786 AAGGCTCAACAATTGGTTCTGGG - Intronic
1160041483 18:75349659-75349681 AAGGGTAACAATTTGGAGCTGGG - Intergenic
1167952452 19:53038095-53038117 CAGGGCAAACCGTTGGTGATTGG + Intergenic
926156132 2:10454934-10454956 AAGGGCAAGCAGCTAGTGCTGGG + Intergenic
927633742 2:24796386-24796408 ATGTGTAAACACTTTGTGCTAGG + Intronic
928788157 2:34915680-34915702 AAGGGTAAGCTGGTGGTGTTAGG - Intergenic
932822775 2:74915591-74915613 AAGGGCCAGCATTTGGTGCTGGG + Intergenic
934639577 2:96019616-96019638 AATGGGAAACAGTGGCTGCTGGG + Intergenic
934794073 2:97085761-97085783 AATGGGAAACAGTGGCTGCTGGG - Exonic
935322814 2:101905652-101905674 AAGGGAAAACACCTGGGGCTGGG + Intergenic
938892573 2:135720402-135720424 GAGGGTTATCAGTAGGTGCTAGG - Intronic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
1169868098 20:10221745-10221767 AAGGGTTAACATTTAGAGCTTGG - Intronic
1172289464 20:33765725-33765747 ATGGTTAAACCTTTGGTGCTAGG - Intronic
1174298500 20:49565891-49565913 AAGGGTCAACAGTGGGTAGTGGG - Intronic
1176657885 21:9604259-9604281 AAGGGTAAAGCATTGGTGATAGG + Intergenic
1177295390 21:19166770-19166792 AAGGGCATCCAGCTGGTGCTGGG + Intergenic
1177570613 21:22881416-22881438 AAGGGAAAACAGTTTGTACTGGG - Intergenic
1178997923 21:37423384-37423406 AAGGGCAAAGAGTGGTTGCTAGG - Intronic
1180173018 21:46070307-46070329 AAGGGTAACCATTTGGTACATGG + Intergenic
1180200436 21:46220803-46220825 AGAGGTAGACAGTTGGGGCTTGG + Intronic
1180200473 21:46220945-46220967 AGAGGTAGACAGTTGGGGCTTGG + Intronic
1181473790 22:23156492-23156514 AAGGGCAGCCAGGTGGTGCTGGG + Intronic
1183562411 22:38585930-38585952 AGGAGTAGAGAGTTGGTGCTTGG - Intronic
1183604280 22:38859644-38859666 AGGGGCAAACAGATGGGGCTGGG + Intergenic
951308264 3:21093414-21093436 AAGGGGTAACACTTGTTGCTTGG + Intergenic
954867391 3:53741511-53741533 AGGGGTAAACAGTTGTTGGTTGG - Intronic
956180836 3:66517069-66517091 AAGGGAAAATAGTGGGTGCAGGG + Intergenic
960279809 3:115768595-115768617 AAGGGTAAAAATTAGATGCTTGG + Intergenic
962192890 3:133329758-133329780 AAGGCTAAACACAGGGTGCTGGG - Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
963161216 3:142152214-142152236 ATGGGAAAACAGTTGGAGATGGG - Intergenic
963726998 3:148934103-148934125 ATTGGTAACCAGTGGGTGCTTGG + Intergenic
963862667 3:150327186-150327208 AAGAGTCAACTGTTGGTGTTTGG + Intergenic
968000338 3:195201338-195201360 AAGGGTTAAAAGTGTGTGCTGGG - Intronic
969164291 4:5293024-5293046 AAGTGTGAACATTTGGTGTTTGG + Intronic
972595672 4:40527854-40527876 AAGGGTAAACAGTTGTAGACTGG - Intronic
972598761 4:40553201-40553223 AAGAGTATACAGTTGGTGATTGG - Intronic
976342664 4:83962915-83962937 AAGGGTAACCTGTTGTTGCCTGG - Intergenic
977508173 4:97928991-97929013 AAAGATAAACAGTGGGTACTGGG - Intronic
985240217 4:187923154-187923176 ATTGGGAAACAGGTGGTGCTTGG + Intergenic
985417525 4:189751824-189751846 AAGGGTAAAGCATTGGTGATAGG - Intergenic
986914859 5:12607061-12607083 ATGGGTAAAGAGTTTCTGCTTGG + Intergenic
988008931 5:25458063-25458085 AAGGGTTAATAATTGGGGCTGGG + Intergenic
992010467 5:72520975-72520997 ATGGGTCAGCAGTTGGGGCTGGG + Intergenic
993194859 5:84728766-84728788 AAATGTAAAAAGTTAGTGCTGGG - Intergenic
993978185 5:94508645-94508667 AAAGGTAAACAATTGTTGCATGG + Intronic
994088629 5:95787815-95787837 AAAGTAAAACAGTGGGTGCTAGG + Intronic
995175062 5:109166640-109166662 TTGGGTCAACAGTTTGTGCTGGG + Intronic
996533590 5:124552147-124552169 CAGGAAATACAGTTGGTGCTGGG - Intergenic
998585051 5:143418706-143418728 AAGGGTAAACAGTTGGTGCTGGG + Intronic
1002281084 5:178130631-178130653 AAGCGTAACCACTTGGGGCTTGG + Intergenic
1004595232 6:17093445-17093467 CAGGGTACACAGTTGGCCCTTGG - Intergenic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1008793038 6:55262227-55262249 TTGGGGAAACAGTTGGTGTTTGG - Intronic
1012133979 6:95532780-95532802 ATGGGGAAACAGTTTTTGCTTGG + Intergenic
1013621404 6:111893378-111893400 AAGTGTAAACATTTAGGGCTGGG - Intergenic
1013684481 6:112563580-112563602 AAGGTTACACAGTAGGTGATGGG + Intergenic
1013794401 6:113869511-113869533 AAGGGAAAAGAGCTTGTGCTGGG - Intergenic
1013950553 6:115776110-115776132 AAGGGGAAAGAGTAGGTACTGGG + Intergenic
1015519160 6:134114273-134114295 GAGGGTGAACATTTGGTGCTGGG + Intergenic
1016619063 6:146086688-146086710 AAGGGTCAATTGTTGGTACTGGG - Intronic
1019273701 7:164822-164844 AACCGTAAACAGCAGGTGCTCGG - Intergenic
1024427730 7:49246875-49246897 AAGGGTAGAGAGTTTGTGCTTGG - Intergenic
1026131320 7:67623091-67623113 AAGGGTTAAGAGTTGGAGATCGG - Intergenic
1027371843 7:77514361-77514383 AATGGTCAAAAGTTGGAGCTGGG + Intergenic
1033419101 7:141190081-141190103 AAGGATAAACAGATGTTCCTTGG + Intronic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1038166527 8:25090248-25090270 AAGGGAAAAAAGATGGGGCTTGG + Intergenic
1038267412 8:26047533-26047555 AGGGGTAAACTGTTGGGGCTTGG - Intergenic
1039515651 8:38130936-38130958 AAGAGTTAACATATGGTGCTGGG - Intronic
1041209754 8:55537159-55537181 TGTGGTAACCAGTTGGTGCTTGG - Exonic
1041486773 8:58386218-58386240 AATGGAAAACAGTTGAGGCTGGG + Intergenic
1042019178 8:64351938-64351960 AAAGGTAAATAGATAGTGCTGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044323858 8:90837924-90837946 AAGGGCAAAAATTTGGGGCTAGG - Intronic
1048248637 8:132838046-132838068 AAGGGTAATCAATAGGTTCTTGG - Intronic
1048923201 8:139249058-139249080 AAGGTTAAATAGTAGGTGCAAGG + Intergenic
1049154506 8:141058680-141058702 AAGGGTCCAGAGTGGGTGCTTGG - Intergenic
1051097283 9:13481101-13481123 AATGGCCAACAGTTGGTGCCAGG + Intergenic
1052348551 9:27434837-27434859 AAGGGCTCTCAGTTGGTGCTGGG + Intronic
1056283165 9:85062261-85062283 AAGGGCAAGCTGGTGGTGCTGGG - Intergenic
1058632159 9:107000380-107000402 AAGGGACAAGAGTAGGTGCTAGG + Intronic
1203635614 Un_KI270750v1:107833-107855 AAGGGTAAAACATTGGTGATAGG + Intergenic
1188157761 X:26761569-26761591 AAGGGTAAATATTTGGAGCTAGG + Intergenic
1192309570 X:69998783-69998805 AAGGGGAAACATGTGTTGCTTGG + Intronic
1196236186 X:113283453-113283475 CAGAGTAAACACTTGGGGCTTGG + Intergenic
1196746879 X:119079173-119079195 AGAGCTAAACACTTGGTGCTGGG - Exonic
1198150631 X:133905059-133905081 ACATGTAAACTGTTGGTGCTTGG - Intronic
1199120606 X:144048663-144048685 TTGGGGAAACAGGTGGTGCTTGG - Intergenic
1200667756 Y:6048490-6048512 TAGGGTCAACTGTTGGTGGTGGG - Intergenic
1201721041 Y:17097595-17097617 AAGGGCCAACAGTTAGTGCCGGG + Intergenic