ID: 998586229

View in Genome Browser
Species Human (GRCh38)
Location 5:143430642-143430664
Sequence GAGGACAGTGAGAAGACAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 499}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998586226_998586229 -9 Left 998586226 5:143430628-143430650 CCTTTCAGCCTCTTGAGGACAGT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG 0: 1
1: 0
2: 6
3: 54
4: 499
998586222_998586229 25 Left 998586222 5:143430594-143430616 CCCTTATGAAAGAGTCTCGGAAG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG 0: 1
1: 0
2: 6
3: 54
4: 499
998586225_998586229 -8 Left 998586225 5:143430627-143430649 CCCTTTCAGCCTCTTGAGGACAG 0: 1
1: 0
2: 2
3: 24
4: 361
Right 998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG 0: 1
1: 0
2: 6
3: 54
4: 499
998586223_998586229 24 Left 998586223 5:143430595-143430617 CCTTATGAAAGAGTCTCGGAAGA 0: 1
1: 0
2: 0
3: 13
4: 126
Right 998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG 0: 1
1: 0
2: 6
3: 54
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998586229 Original CRISPR GAGGACAGTGAGAAGACAGC GGG Intronic
900099562 1:955783-955805 GGGGACCCTGAGAAGGCAGCGGG - Intronic
900104113 1:974920-974942 GAGGACAGAGAAAGGTCAGCAGG + Exonic
900738562 1:4316203-4316225 GTGCATAGAGAGAAGACAGCTGG + Intergenic
901065995 1:6494966-6494988 GAGGCCTGGGAGAAGAGAGCTGG - Intronic
901078827 1:6572128-6572150 GAGGGCAGGGAGAGGCCAGCAGG - Intronic
901712444 1:11126309-11126331 GAGGCCAGGGAGGAGGCAGCTGG - Intronic
902405882 1:16183413-16183435 GAGGACCGAGAGGAGAGAGCCGG - Intergenic
902964221 1:19986699-19986721 GAGGAAAATGAGAAGATAGTAGG - Intergenic
903182360 1:21611407-21611429 GAGGACAGGTGGAAGACAGGAGG + Intronic
904298775 1:29540949-29540971 GGGGACAGTGAGAAGGAAGAGGG - Intergenic
904324813 1:29721474-29721496 GAGCACAGTGACAACAGAGCAGG - Intergenic
904871991 1:33624866-33624888 GTGGGCTGTGTGAAGACAGCCGG - Intronic
904984137 1:34530648-34530670 GAGGTCAGTGTGAGGACAGTAGG + Intergenic
906669457 1:47643917-47643939 ATGGAGAGTCAGAAGACAGCAGG - Intergenic
907442355 1:54487004-54487026 GAAACCAGTGAGAAGAGAGCTGG - Intergenic
910216103 1:84846623-84846645 GAGGTCAGTGAGAAGTCTCCTGG + Intronic
910459780 1:87436704-87436726 GGGGGCAGGGAGCAGACAGCAGG - Intergenic
911728309 1:101265761-101265783 GAAGTCAGTTAGAGGACAGCTGG - Intergenic
911902977 1:103528442-103528464 GAAGACAGTAAGAAGACAAAGGG + Intronic
912198575 1:107429031-107429053 GAGGACAGGAAGAAGTCAGAGGG - Intronic
912304923 1:108557677-108557699 GAGGACACAGAGAAGTAAGCAGG - Intergenic
913173111 1:116249978-116250000 GGACACAGTGAGAAGACAGCTGG + Intergenic
913286663 1:117232960-117232982 GAGGACAGAGGGCAGCCAGCAGG - Intergenic
914248363 1:145902041-145902063 GGGGTCACTGAGAAGACAGTGGG + Intronic
914317007 1:146522974-146522996 GTGGGCAGGGAGCAGACAGCAGG - Intergenic
914497348 1:148210386-148210408 GTGGGCAGGGAGCAGACAGCAGG + Intergenic
915307241 1:154987634-154987656 GGGGACAGAAAGAAGAAAGCAGG + Intronic
915939608 1:160110541-160110563 GGGGACTGTGAGAGGACAGGAGG + Intergenic
916577578 1:166081348-166081370 GAGGACTCTGAGAACCCAGCTGG - Intronic
917724463 1:177815684-177815706 GAGGAGAGTGAGCTGAGAGCTGG + Intergenic
918587455 1:186204148-186204170 TAGGACAGTGTGAAGCCACCTGG - Intergenic
920258424 1:204672493-204672515 GAGGACAGTGAGAAAGCAGTGGG + Intronic
920955906 1:210619930-210619952 GAAGACAGTGAAAAGCCATCAGG - Intronic
922234962 1:223715640-223715662 GGGTACAGTGAGGAGAAAGCAGG + Intronic
922905710 1:229172183-229172205 GAAGACACTGAGAAAGCAGCAGG - Intergenic
922966378 1:229694358-229694380 GAGCCCAGTGAAGAGACAGCAGG + Intergenic
923854051 1:237827219-237827241 GAAGAAAGTGTGAAGCCAGCAGG + Intronic
924378813 1:243441423-243441445 CAGGACCGTGAAAAGAGAGCAGG - Intronic
1063933247 10:11050702-11050724 GGTGACAGAGAGAAGACAGGAGG - Intronic
1064417649 10:15164567-15164589 AAGGACAGCGAGAAGACAGTGGG + Intronic
1064910785 10:20399587-20399609 AAGGACAGTGTGAAGGCAGAGGG + Intergenic
1064974162 10:21096232-21096254 AAGGACAGTGGGAAGAGAGAGGG - Intronic
1065015246 10:21456832-21456854 GAAGACAGTGTGAAGACACCAGG - Intergenic
1065522913 10:26589202-26589224 GAGGAAAGTAAGAAACCAGCTGG - Intergenic
1065528837 10:26648473-26648495 GAGGAAAGTAAGAAACCAGCTGG - Intergenic
1065866467 10:29919286-29919308 GAGGAGAAGGAGAAGAAAGCAGG - Intergenic
1066229022 10:33413777-33413799 GAGGACAGTGAGAAGAGAACAGG + Intergenic
1066640952 10:37553570-37553592 AAGGACAGTGGGGAGAGAGCTGG + Intergenic
1067278162 10:44852309-44852331 GAGGAGAGGAGGAAGACAGCTGG + Intergenic
1068743423 10:60501196-60501218 GAGGACAGTGGGCTGAGAGCAGG + Intronic
1068912025 10:62388636-62388658 GAGGACAGAGAAAAGGGAGCTGG + Intronic
1069494777 10:68893732-68893754 GATGGCAGTGAGAAGTCAGATGG + Intronic
1069800427 10:71078398-71078420 CAGGCCAGTGAGAGGACAGATGG + Intergenic
1070553757 10:77512723-77512745 GAAGACAGTGTGAAGACATGGGG + Intronic
1070575826 10:77678107-77678129 GGGGACAGAGAGAAGGGAGCAGG - Intergenic
1070727120 10:78799987-78800009 GGGGAGAGTGAGAAGACAAAAGG - Intergenic
1070767272 10:79063996-79064018 GTAGAAAGTGAGAAGACGGCTGG + Intergenic
1071787981 10:88924391-88924413 GAAGACATTGGGAAGACAGAAGG - Intronic
1071810594 10:89176829-89176851 GAGGAAAGTGAGAATACAACTGG - Intergenic
1073082562 10:100869150-100869172 GTGGGCAGAGAGAAGGCAGCAGG - Intergenic
1074774044 10:116753320-116753342 GAGGACCCTGAAAAGACACCTGG + Intergenic
1074900775 10:117814972-117814994 GTGGGCAGTGAGGAGACAGACGG - Intergenic
1075380286 10:122013234-122013256 GAGGAAAGGAAGAAAACAGCAGG + Intronic
1075557909 10:123446792-123446814 GGGGACAGGGAGAAGACAGAGGG - Intergenic
1076024580 10:127101041-127101063 GAGGGCCTTGAGCAGACAGCAGG + Intronic
1076045089 10:127286031-127286053 GAGCCCAGTGGGAAGCCAGCTGG - Intronic
1076254797 10:129013624-129013646 GGTGGCAGTGAGAAGTCAGCTGG + Intergenic
1076321328 10:129584097-129584119 GAGGTCAGAGAGTAGACAGAGGG + Intronic
1076696124 10:132248270-132248292 GAGGAGAGTGAGAGGGCAGCTGG + Intronic
1077010487 11:377107-377129 GAGGACAGCGAGGAGGCCGCGGG + Exonic
1077376461 11:2207418-2207440 GTGGGCAGTCAGACGACAGCTGG + Intergenic
1078133257 11:8630955-8630977 GAGGAGAGAGAGAGGGCAGCAGG - Intronic
1078182716 11:9026149-9026171 GATGACAATTAGATGACAGCAGG - Intronic
1079009713 11:16817982-16818004 AAGAGCAGTGAGAAAACAGCAGG - Intronic
1079904149 11:26224083-26224105 GAGGACCTTGAGATGGCAGCTGG - Intergenic
1080183825 11:29455579-29455601 GAGGACATAGATAAGACATCTGG - Intergenic
1080740083 11:35055739-35055761 GAGTACAGAGTGAAGCCAGCGGG - Intergenic
1080842503 11:35997891-35997913 GATGACAGCGAAAAGACAGGAGG - Intronic
1081618544 11:44604914-44604936 TTGGGCAGTGAGAAGCCAGCAGG + Intronic
1081674439 11:44960386-44960408 GGGGGCAGGGAGACGACAGCAGG - Intergenic
1081934740 11:46896865-46896887 GAGAACTGTGAGAATACAGGTGG - Exonic
1081979025 11:47254714-47254736 GCAGAGTGTGAGAAGACAGCAGG - Intronic
1083295310 11:61712181-61712203 GGGCACAGAGAGAACACAGCAGG + Intronic
1084634146 11:70379181-70379203 GAGGCCAGTGAGCAGACTGGAGG + Intronic
1084780122 11:71402543-71402565 GGGGACAGTGGGGAGACAGCAGG + Intergenic
1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG + Intronic
1085409900 11:76284688-76284710 CAGGGCAGGGTGAAGACAGCAGG + Intergenic
1085820041 11:79782726-79782748 GAAGACAGCGAGACGGCAGCAGG - Intergenic
1086321077 11:85648217-85648239 GTGCAAAGTGAAAAGACAGCAGG - Intronic
1086501763 11:87461103-87461125 AAGGACAGTGAGATGGCAGCTGG - Intergenic
1086903996 11:92398174-92398196 GAAGACAATGTGAAGACAGGGGG - Intronic
1089387030 11:118075141-118075163 CAGGGCAGTGAGAAGCCAGTGGG - Intergenic
1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG + Intronic
1089770537 11:120799311-120799333 GAGGACAGGGAGAAGGGAGGAGG + Intronic
1089788736 11:120926987-120927009 CAGAACGGTGAGAAGCCAGCTGG + Intronic
1090232755 11:125120648-125120670 GGGGACAGGGAGAAGAAAGGAGG + Intergenic
1090363032 11:126186504-126186526 GAGGCCAGGGAGTGGACAGCTGG + Intergenic
1090478933 11:127050537-127050559 TAGGGCATTGAGAAGACAGAGGG - Intergenic
1090581944 11:128170279-128170301 GAGGAAAGTGAGATTACAGAGGG + Intergenic
1090610711 11:128467937-128467959 GTGGAGAGGGAGCAGACAGCAGG - Intronic
1090614237 11:128500204-128500226 GAGGAGAGAGGGAAGAAAGCAGG + Intronic
1091645422 12:2269005-2269027 CAGGACAGTGGGCAGAGAGCCGG - Intronic
1091818000 12:3454142-3454164 CAGGAGAGTGAAGAGACAGCAGG - Intronic
1092035787 12:5333304-5333326 GAGCACATTGGGAAGACATCAGG + Intergenic
1092036172 12:5336891-5336913 GAGGAAGGTGAGAAGAAAGGAGG - Intergenic
1092096678 12:5848591-5848613 AAAGCCAGTGAGAAGACTGCTGG - Intronic
1092111230 12:5966144-5966166 CAGGGCAGTCAGGAGACAGCAGG - Intronic
1094526956 12:31237525-31237547 GAGGAAACTGAGAAGACATCAGG + Intergenic
1096808929 12:54157549-54157571 GAGGACAGTGAGGAGTCAGGTGG + Intergenic
1096903927 12:54915840-54915862 GAGAACAGTAAGAAGTCAACAGG - Intergenic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1097271108 12:57774779-57774801 GTGAACAGTGTGAACACAGCAGG + Intronic
1097606697 12:61763796-61763818 GAGGTCAGAGAGAAGGGAGCAGG + Intronic
1098385686 12:69916291-69916313 GAGGAAGGAGAGAAGAAAGCTGG + Intronic
1098524396 12:71469997-71470019 GAGGACAGTCAGCCCACAGCGGG - Intronic
1098637412 12:72801502-72801524 GAGGTCAGTAAGAAGAAACCAGG - Intergenic
1100616848 12:96237449-96237471 GGGGACAGTGAGCAGTCAGCTGG - Intronic
1100979597 12:100154033-100154055 GAGAAAAGTGAGGAGAGAGCTGG - Intergenic
1102527951 12:113525281-113525303 GAGAACAGAGAGGAGACACCTGG - Intergenic
1102787215 12:115614629-115614651 GAGGACAGAGGGACCACAGCTGG + Intergenic
1103076413 12:117986331-117986353 GGGTACAGTGAGAAGATGGCTGG + Intergenic
1103403528 12:120659276-120659298 GAGGACAGGGAGGAGTCAGGAGG - Intronic
1103918012 12:124385902-124385924 GAGGGCAGTGAGAAGAGGCCAGG + Intronic
1103994160 12:124818261-124818283 GAGCACAGAGAAAACACAGCAGG + Intronic
1104310541 12:127650905-127650927 GGTTACAGGGAGAAGACAGCAGG - Intergenic
1104376419 12:128267892-128267914 GTGGACAGGGAGCACACAGCCGG - Intronic
1104816584 12:131649710-131649732 GAGGACAGAGAGGAGAGGGCAGG - Intergenic
1105278259 13:18948566-18948588 GAGCAGAGGGAGAGGACAGCAGG - Intergenic
1106526898 13:30548872-30548894 AAGGACATTGTGCAGACAGCTGG + Intronic
1106582862 13:31032669-31032691 GGAGACAGTGAGAAGAGAGTTGG - Intergenic
1108471013 13:50766896-50766918 GTGCACAGCCAGAAGACAGCTGG + Intronic
1110278252 13:73662502-73662524 GAGGAAAGTGAGGAAACAGCTGG + Intergenic
1110296930 13:73878559-73878581 GAGGACCATGAGAAGATAACCGG - Intronic
1113167417 13:107458016-107458038 GAGGGCAGTGAGAGGACAAGGGG - Intronic
1114163054 14:20190462-20190484 GAGGGCAGTGTAATGACAGCAGG - Intergenic
1114378698 14:22177355-22177377 TAGGACTGGGAGAAGACAGTGGG + Intergenic
1114564729 14:23622178-23622200 CAGGAGAGTGAAAAGACAGAAGG - Intergenic
1114809592 14:25882005-25882027 GAGGAAAGTGAACAGAAAGCAGG - Intergenic
1114863677 14:26559698-26559720 GAAGACAGAGAGTAGACTGCTGG + Intronic
1115426987 14:33271461-33271483 GAGGCCAGAGACAAGAGAGCAGG + Intronic
1115474348 14:33799672-33799694 GAGAAGAGAGAGAAGACACCAGG - Intronic
1115529147 14:34310797-34310819 GAGGCCATTGAAAAGACTGCTGG - Intronic
1116958295 14:50945221-50945243 GAGGAGAGGGAGAAAACAGAAGG + Intergenic
1117720043 14:58620136-58620158 GAGGACAGTGAAAAGAGACCTGG - Intergenic
1117959929 14:61152899-61152921 GTAGACAGTGGGGAGACAGCTGG + Intergenic
1118983793 14:70736129-70736151 CTGGACAGTGGGAAGGCAGCTGG - Intronic
1119414925 14:74463497-74463519 GACGACAGTGGGAAGAGGGCAGG - Intergenic
1120947945 14:90015657-90015679 GGACACAGTGAGAAGTCAGCAGG - Intronic
1121201361 14:92121250-92121272 GAGGTTAGCGAGAAGACAGAAGG + Intronic
1121314773 14:92954361-92954383 GAGGCAAGTGAGAAGGCATCAGG + Intronic
1121410798 14:93746985-93747007 GGAGACAGTGAGAAAGCAGCTGG + Intronic
1121574462 14:94972190-94972212 GGGGACAGTGAGAATGCAGAGGG + Intergenic
1121695323 14:95907882-95907904 GAGGACAGAGAGACCACAGGAGG - Intergenic
1122310072 14:100788766-100788788 GGGGAGAGTCAGAGGACAGCGGG - Intergenic
1122366581 14:101198103-101198125 GAGGCCAGTGAGGAGAGGGCAGG + Intergenic
1122971831 14:105155333-105155355 GAGGACAGTGAGGAGAGACTGGG - Intronic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1125348471 15:38742976-38742998 GAGGACAGGAAGTAGCCAGCTGG + Intergenic
1126435287 15:48631399-48631421 GAGGACAGTGATAACAGAGTGGG + Intronic
1126666635 15:51081264-51081286 GAGGACAGGGTGAAGTCAGGAGG + Intronic
1127349588 15:58137185-58137207 GAGGACATGGAGAAAGCAGCTGG - Intronic
1127932990 15:63609720-63609742 GAGGACAGGGAGAGGAGAGGGGG - Intronic
1128282691 15:66409508-66409530 GAGGAGTGTGAGAAGCCACCAGG - Intronic
1128755607 15:70181621-70181643 GAGGCCAGAAAGAAGAGAGCAGG - Intergenic
1129137857 15:73570271-73570293 GAGGACAGTGACAACAGAGGCGG + Exonic
1129150023 15:73682734-73682756 GTGGTCAGGGACAAGACAGCTGG + Intergenic
1129210465 15:74065109-74065131 GAGAAAAGTGAGCAGAGAGCTGG - Intergenic
1129665630 15:77578002-77578024 GAGGAGGGTGAGAAGGCTGCAGG + Intergenic
1131117315 15:89803318-89803340 GGGCACAGTGAGAGCACAGCTGG + Intronic
1131422209 15:92316653-92316675 GAGCAGAATGACAAGACAGCAGG - Intergenic
1131780947 15:95858082-95858104 GAGGAAAGTGGGTAGACAGCTGG + Intergenic
1132419002 15:101648522-101648544 CAGGAGAGTGAGAAGTGAGCCGG + Intronic
1132949037 16:2550081-2550103 GGGGACACTGAGTATACAGCAGG - Intronic
1132965551 16:2652046-2652068 GGGGACACTGAGTATACAGCAGG + Intergenic
1133600244 16:7333201-7333223 GTAGTCAGTGAGAAGACAGTAGG + Intronic
1133631374 16:7625233-7625255 GGTGACAAGGAGAAGACAGCAGG + Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1133911309 16:10069000-10069022 GAGGAGAGGGATAAGACAGGTGG + Intronic
1134202334 16:12209517-12209539 CTGGAGAGTGAGAGGACAGCAGG - Intronic
1135955711 16:26954852-26954874 AGGGACAGACAGAAGACAGCTGG - Intergenic
1136040063 16:27571664-27571686 GAGGCCAGTGAGATGCCAGCAGG - Intronic
1136367265 16:29814537-29814559 GAGGACAGACAGGAGAGAGCAGG - Exonic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1139539748 16:67605820-67605842 GAAGACAGGGAGATGACAGTAGG + Intronic
1139854489 16:69969603-69969625 GAGGACAGTGAAAATCCAGCTGG - Intergenic
1139883469 16:70192518-70192540 GAGGACAGTGAAAATCCAGCTGG - Intergenic
1140369042 16:74403001-74403023 GAGGACAGTGAAAATCCAGCTGG + Intergenic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1141268843 16:82520974-82520996 GTAGACAGAGAGAAGACAGGAGG + Intergenic
1141859820 16:86708829-86708851 GAGGACAGGGACAATAGAGCTGG + Intergenic
1141869973 16:86778645-86778667 AAGGACAGTTTGAGGACAGCTGG - Intergenic
1142467611 17:145194-145216 CAGGACAGTGACAAGACCCCAGG + Intergenic
1142780137 17:2175229-2175251 GACGACAGTGAGAAGGAAGAAGG + Intronic
1143356237 17:6330930-6330952 GGGGACAGAGAGTAGAGAGCTGG - Intergenic
1143370752 17:6437570-6437592 GGTGACAGGGAAAAGACAGCAGG - Intergenic
1143594743 17:7907470-7907492 GGGGACAGAGAGAAGTCAGGTGG + Exonic
1143972340 17:10804672-10804694 GGGGACAGAGAGAAGACAACAGG + Intergenic
1144147928 17:12416167-12416189 GGACACAGTGAGAAGACAGTGGG - Intergenic
1144891112 17:18494832-18494854 GAGGCCAGTGGGAAGCCATCAGG - Exonic
1145794815 17:27649447-27649469 GAGGCCAGTGGGAAGCCATCAGG - Exonic
1146168327 17:30610921-30610943 AAGGACAGTTAGAAGACAGTAGG + Intergenic
1147057219 17:37843958-37843980 CAGGACAGTGACAAGACCCCAGG - Intergenic
1147314317 17:39612367-39612389 GAGGGGGGTGAGAAGACAGGTGG - Intergenic
1147871187 17:43588766-43588788 GAGGACAGTCAGAAGAGAGCAGG - Intergenic
1148001609 17:44390979-44391001 GAGGACAGTGGGAGGATAGAAGG - Intergenic
1148064670 17:44860279-44860301 GAGTACAGGGAGAATCCAGCAGG + Intronic
1148712482 17:49691891-49691913 GAGGATAGTGGGAGGAAAGCAGG + Intergenic
1148739729 17:49886015-49886037 AAGGACATTGAGAAGATATCTGG + Intergenic
1148749780 17:49938865-49938887 CAGGGCTGTGTGAAGACAGCAGG - Intergenic
1148792761 17:50183023-50183045 GGAGACAGCGAGACGACAGCTGG - Intergenic
1149083065 17:52681103-52681125 GAGGACAGAGAACAGAGAGCGGG + Intergenic
1149318232 17:55458746-55458768 CAGGGCAGTGGGAGGACAGCCGG + Intergenic
1149324682 17:55517735-55517757 GGAGATGGTGAGAAGACAGCTGG + Intergenic
1149556929 17:57580095-57580117 GGGAACAGAGAGGAGACAGCTGG - Intronic
1149578134 17:57728362-57728384 GAGGACAGGGAGGAGTTAGCTGG + Intergenic
1150281795 17:63933172-63933194 GAGGACAGGCAGGATACAGCTGG - Intergenic
1150302221 17:64056074-64056096 GAGACCAGTGAGAAGGCACCTGG + Intronic
1150454979 17:65300058-65300080 AAAGACAGGGAGAAGACAGCTGG + Intergenic
1150461959 17:65360959-65360981 GAGGGCTCTGGGAAGACAGCAGG - Intergenic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1151990852 17:77572994-77573016 GAGGGCCGTGAGGACACAGCAGG + Intergenic
1152812358 17:82388051-82388073 GAGGACAGAGACAAGACAGAGGG + Intergenic
1153568607 18:6445830-6445852 GAGGACAGTGAGACCACAGAGGG - Intergenic
1153732644 18:8029818-8029840 GTGGACATTGGGAAGACATCAGG - Intronic
1154103085 18:11494845-11494867 AAGGCCAGCGAGAAGACATCAGG - Intergenic
1155210603 18:23597350-23597372 GAGCAAAGATAGAAGACAGCAGG - Intergenic
1155612122 18:27677589-27677611 GTGAACAGTGAAAGGACAGCAGG - Intergenic
1156514201 18:37666331-37666353 CAGGACAGTTAGGAGGCAGCTGG + Intergenic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1156851760 18:41736930-41736952 GAGGACAGTTGGAAGGCAGGAGG + Intergenic
1158119649 18:54034423-54034445 GAGGACACTGACAAGAGTGCTGG - Intergenic
1158498983 18:57983187-57983209 TAGGGAACTGAGAAGACAGCTGG + Intergenic
1158616954 18:58996760-58996782 AAGGAAATTGAAAAGACAGCAGG - Intergenic
1158747387 18:60217198-60217220 GAGAACAGAGAGAACAGAGCTGG + Intergenic
1159045097 18:63362120-63362142 GAGGAAAGTGACCACACAGCTGG - Intronic
1160361948 18:78290769-78290791 CAGAATAGTGGGAAGACAGCGGG - Intergenic
1160844221 19:1159533-1159555 GGGGACAGTGGGGGGACAGCAGG + Intronic
1161357433 19:3826764-3826786 GAGAACAGTGATACTACAGCAGG + Intronic
1162380513 19:10329124-10329146 GAGGGCAGTGCGAGGTCAGCCGG + Intronic
1162733285 19:12731656-12731678 GTGGAAAGTGAGAACAGAGCTGG - Intronic
1163034153 19:14561935-14561957 GAGGAGAGTGAGAGGCCAGCGGG - Intronic
1163105810 19:15122581-15122603 GTGGACTGGGAGGAGACAGCTGG - Intronic
1163205294 19:15798239-15798261 AAGTTCAGTGAGAACACAGCAGG + Intergenic
1164587361 19:29484386-29484408 AGGGACAGTGAGGAGCCAGCCGG + Intergenic
1164597478 19:29539743-29539765 GAGGCTAGTGAGAAGAATGCAGG + Intronic
1165311712 19:35032512-35032534 GAGGACACTGTGGGGACAGCAGG - Exonic
1165390776 19:35537477-35537499 GAGGCCAGTGAGAAGCCCGGAGG + Intronic
1165505901 19:36229253-36229275 GAGATGAGTGAGAAGACAACGGG - Intronic
1166088665 19:40493833-40493855 GGGGAGAGAGAGAAGAGAGCAGG - Intronic
1166982761 19:46640921-46640943 GGGGACAGGGAGAAGATAGGAGG - Intergenic
1167477775 19:49710840-49710862 GAGGACAAAGAGAAGACGGTGGG + Exonic
1168296155 19:55378162-55378184 GAGGAGGGTGAGGAGACAGAGGG + Exonic
926590626 2:14736302-14736324 GAGGCCAATGAGGACACAGCAGG - Intergenic
927889897 2:26741735-26741757 GAGAACAGTGAGAAGAGCCCGGG + Intergenic
927960525 2:27238276-27238298 GAGGAGAGTCTGGAGACAGCAGG + Intronic
928103470 2:28452808-28452830 GAGTGGAGTGAAAAGACAGCTGG - Intergenic
928228617 2:29476727-29476749 GAAGACAGGGAGAAGAGACCAGG + Intronic
928350282 2:30546107-30546129 GAGATCAGAGAGAAGCCAGCAGG + Intronic
928876190 2:36042564-36042586 GGGGCCAGGGAGAATACAGCAGG - Intergenic
929998377 2:46844141-46844163 GGAGACAGGGAGAAGACAGAAGG - Intronic
930425676 2:51209552-51209574 GAGGACAATGGGAAGACATGTGG + Intergenic
932698889 2:73979749-73979771 TTGGCCAGTGAGATGACAGCAGG + Intergenic
933064789 2:77779737-77779759 CAGGAGAGTGAAAAGACAGAAGG + Intergenic
934859893 2:97755709-97755731 GGGCACAGAGGGAAGACAGCAGG - Intergenic
934859898 2:97755731-97755753 GGGCACAGAGGGAAGACAGCAGG - Intergenic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
935523345 2:104136964-104136986 CAGGAAAGAGAGAAGACAGCAGG + Intergenic
935692493 2:105744528-105744550 GAGGAGAGTGAAAACACAGACGG - Intergenic
935791458 2:106594821-106594843 GAAAACAGTGAGAAAACATCAGG - Intergenic
935805605 2:106744590-106744612 AAGGACCGTGTGAAGACAACGGG + Intergenic
936242426 2:110799444-110799466 GAGCACAGAGAGCAGACAGGTGG - Intronic
936286307 2:111184095-111184117 GTGGAGTGTGAGAAGACAGCAGG - Intergenic
937104212 2:119294937-119294959 TGGGATAGTGAGAAGACAGCAGG + Intergenic
937216555 2:120316941-120316963 AAGAACAGGGAGAAGACAGCTGG - Intergenic
937307478 2:120881372-120881394 GAGGACAGTGGGGAGAGGGCAGG + Intronic
937307575 2:120881657-120881679 GAGGACAGTGTGGGGACGGCAGG + Intronic
937307590 2:120881698-120881720 GAGGACAGTGGGGAGAGGGCAGG + Intronic
938263972 2:129913263-129913285 GAGGCCAGTCACAGGACAGCAGG + Intergenic
938287631 2:130130456-130130478 GAAGACTGTGAAAAGACAGTAGG + Intergenic
938427962 2:131208403-131208425 GAAGACTGTGAAAAGACAGTAGG - Intronic
939922549 2:148135038-148135060 GAGGACAGAGAGAAAAGAACTGG - Intronic
940075773 2:149740424-149740446 GAAGTCAATGAGAAGAGAGCAGG - Intergenic
941733832 2:168949947-168949969 GAGGGCAGGAAGAATACAGCAGG - Intronic
942247270 2:174019345-174019367 GAGGAGAGTGAGATGAAAGACGG + Intergenic
942270441 2:174268910-174268932 GATGACAATGTGAAGACAGAAGG + Intergenic
942997811 2:182285749-182285771 GAGGACAGTGAGGAAACACATGG + Intronic
943574622 2:189616451-189616473 CAGGGCAGTGTGAAGACAGGTGG + Intergenic
943747055 2:191472813-191472835 GAGGACAGAGAATTGACAGCTGG - Intergenic
944070559 2:195663219-195663241 GAGGGGAGTGAGAAGATAGGAGG - Intronic
945177748 2:207060623-207060645 GAGGACAGAGAGGAGTCCGCTGG - Intergenic
945345261 2:208705933-208705955 GAAGACAGTGTGAAGACACAAGG - Intronic
945609445 2:211980935-211980957 GAGTACAGTGAAAGAACAGCAGG + Intronic
946044972 2:216813368-216813390 GAAGACAGTGTGAAGACACGGGG - Intergenic
946495137 2:220188910-220188932 GAGGACTGGCAGAAGATAGCAGG - Intergenic
946546307 2:220748228-220748250 AAGGATACTGAGAAGACAGCTGG + Intergenic
947437780 2:230087718-230087740 GTGGACAGTCAGATGTCAGCTGG + Intergenic
947872001 2:233444465-233444487 GAGGACAGCGAGGAAACAGGAGG - Intronic
948353491 2:237359737-237359759 GAGTGGAGTGAGAGGACAGCAGG - Intronic
948424642 2:237879266-237879288 GAGGCCTGGCAGAAGACAGCAGG + Intronic
948676341 2:239599082-239599104 CAGGATAGTGAGAAGAGAACAGG - Intergenic
948677581 2:239607835-239607857 GAGGACAGGGAGAAGGTTGCTGG + Intergenic
948992886 2:241563684-241563706 GAGGCCACAGAGATGACAGCAGG - Intronic
1168891727 20:1299446-1299468 CAGGACACTGAGAATAGAGCTGG + Intronic
1169029506 20:2396691-2396713 GAGAAGAGTGAGCAGACAGAGGG - Intronic
1169152902 20:3304496-3304518 GACGACAGTGAGAAAACAGAAGG + Exonic
1169206947 20:3745881-3745903 GGGGGCAGTGAGAGGAAAGCTGG - Intronic
1169383593 20:5128842-5128864 GAGGAGAGAGAGAAGAAAGAAGG + Intronic
1169429806 20:5526278-5526300 TAGGACACTGGGAGGACAGCAGG - Intergenic
1169916580 20:10689602-10689624 GAGGGCAGTTAGAAGAGAGTGGG - Intergenic
1170525058 20:17228365-17228387 GAGGACAGAGAGAAGGGCGCTGG + Intronic
1171149525 20:22814996-22815018 GAGGACAGTGAGGAAGCAGCTGG + Intergenic
1171990854 20:31695194-31695216 GAGACCAGTGAGAAGCCAGGTGG - Intronic
1172234684 20:33363325-33363347 AAGGACAGTTCGAAGACAACTGG + Intronic
1172707643 20:36894100-36894122 GAGGACAGTGATTCAACAGCAGG - Exonic
1172840477 20:37900246-37900268 GGGGACTGGGAGAAGGCAGCAGG + Intergenic
1173525771 20:43731466-43731488 GAGGGGAGTGAGAGGAAAGCAGG - Intergenic
1173846496 20:46191899-46191921 GAGGCCAGAGAGACCACAGCAGG - Intronic
1174182560 20:48684007-48684029 CAGGACAGTGTGAGGAGAGCTGG + Intronic
1175343441 20:58250625-58250647 TTGGACAGTGAGAAGAAGGCAGG + Intergenic
1175578835 20:60083001-60083023 GAGGACAGTCAGGAGGCAGGTGG + Intergenic
1176306009 21:5123501-5123523 AAGGGCACTGAGAAAACAGCTGG + Intronic
1176612594 21:8998135-8998157 AAGGCCAGTGAGCAGACAGAGGG - Intergenic
1176712528 21:10165306-10165328 AAGGCCAGTGAGCAGACAGAGGG + Intergenic
1176968228 21:15235825-15235847 CAGGCAAGAGAGAAGACAGCAGG - Intergenic
1177751668 21:25292681-25292703 GAGGACAGGGAGAAGACAAAGGG - Intergenic
1179851048 21:44138530-44138552 AAGGGCACTGAGAAAACAGCTGG - Intronic
1179907790 21:44433225-44433247 GGGGACAGTGAGATGACAGCAGG + Intronic
1180929503 22:19579302-19579324 GAGGACAGGAAGAACCCAGCTGG - Intergenic
1182301589 22:29340177-29340199 GAGGGGAGTGGGAAGACAGTAGG - Intronic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1182660086 22:31919013-31919035 AAGGGCAGTGATATGACAGCAGG - Intergenic
1183489985 22:38111009-38111031 GAGGACAGTGAGAAGTAAAGCGG - Intergenic
1183927026 22:41213585-41213607 GAGGAAAGTGAGAAGAAACTAGG - Intronic
1184792997 22:46712634-46712656 GAGGTGAGTGTGCAGACAGCAGG + Intronic
1184950854 22:47841748-47841770 GAAGTCACTGAGAAGACATCAGG + Intergenic
1185182072 22:49369399-49369421 GGGGACAGTGAGCTGAGAGCAGG - Intergenic
949854381 3:8447658-8447680 CAGGACAGTGAAAAGACAACGGG - Intergenic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
952553973 3:34511016-34511038 GAGGAAAGGGAGAAGACAAGGGG - Intergenic
953117907 3:40010814-40010836 GATGACAGTGAAAGGAAAGCAGG - Intronic
953127956 3:40109904-40109926 GAGGACATAGCTAAGACAGCAGG - Intronic
953591360 3:44258438-44258460 GAGGAAAGAGAGAAGAAAGTAGG - Intronic
954716188 3:52528086-52528108 GAGGACAATGAGGGTACAGCAGG + Intronic
954865397 3:53724745-53724767 GAGGAAAGGCAGCAGACAGCTGG + Intronic
955628425 3:60946108-60946130 GAGGAAAGTGAGGATACAGGAGG + Intronic
955889771 3:63637440-63637462 CAGGAGAGAGAGAAGAAAGCAGG - Intergenic
956051330 3:65251556-65251578 GAGGACTGTGAGGAGAAAGACGG - Intergenic
956278993 3:67536462-67536484 GATGGCAGTGAACAGACAGCAGG - Intronic
956749492 3:72334922-72334944 GAAGACAGTGAGAAGACACCAGG + Intergenic
959374300 3:105569284-105569306 GAGGACTGAGAGAAGACAAGGGG + Intronic
960081308 3:113543378-113543400 GTGCTCAGTGAGAAGACTGCAGG - Intronic
960470259 3:118055609-118055631 GAGAAAAGTGAGAAAGCAGCTGG + Intergenic
961427188 3:126857529-126857551 GGTGTCAGTGAGAAAACAGCAGG - Intronic
962157390 3:132962467-132962489 GAGGACAGTTTGAAGCTAGCAGG - Intergenic
962280878 3:134050946-134050968 GAGGTCAGAGAAAAGACAGATGG - Intronic
963258453 3:143169671-143169693 GAGACCAGTGAGAAGACAGTGGG - Intergenic
963344929 3:144084036-144084058 AAGGACAATGAGAGGTCAGCTGG - Intergenic
963626274 3:147678114-147678136 TAAGACACTGAGAAGAAAGCAGG + Intergenic
963936383 3:151058111-151058133 GAGGAAAGAGTGAACACAGCAGG - Intergenic
966170659 3:177076346-177076368 GAGAACAGTGTGAAGACACAGGG - Intronic
966386273 3:179402594-179402616 AAGGACAGTGAGATGAGAGCAGG + Intronic
966869516 3:184281047-184281069 GAGGACAGAGAAAGGACAGAAGG + Intronic
967046883 3:185745611-185745633 GAGGACAGACAGAAGACGGTTGG - Intronic
967338100 3:188366859-188366881 CAAAACAGTGAGAAGACATCAGG - Intronic
967942884 3:194779906-194779928 AAGGTCAGTGGGCAGACAGCAGG - Intergenic
968283793 3:197496414-197496436 CAGGACAGACAGCAGACAGCAGG - Intergenic
968461189 4:725886-725908 GAGGCCAGTGAGGGGCCAGCTGG - Intronic
968574361 4:1358124-1358146 AAGGACAGTGGGATGGCAGCAGG - Intronic
969266806 4:6069931-6069953 TAGGAAGGTGAGAAGACAGGTGG - Intronic
969353570 4:6612363-6612385 GAGGAGTGTGAGACCACAGCTGG + Intronic
969447792 4:7255546-7255568 GTGGACAGGGAGAAGGCATCAGG - Intronic
969493070 4:7510874-7510896 GAGGAAAGTGTGAAGTCAGGCGG - Intronic
969717893 4:8877281-8877303 GAGGAGAGGGAGAAGAAAGGGGG + Intergenic
970656903 4:18241360-18241382 GAGGGGAGAGAGAAGAAAGCTGG - Intergenic
971407105 4:26331872-26331894 GAGGAGAGTGAAAAGAAAGAAGG + Intronic
972589531 4:40471326-40471348 GTGGATAGGGAGAAGCCAGCTGG - Intronic
972662152 4:41126750-41126772 GAGGACACTGTGAAGACATAGGG - Intronic
972943751 4:44228278-44228300 GAAGACCATGAGAAGACAGAGGG - Intronic
974474819 4:62365117-62365139 AAGGACAGAGAGATGACAACAGG + Intergenic
975135821 4:70873423-70873445 GAGCGCAGTCCGAAGACAGCAGG - Intergenic
975627453 4:76363898-76363920 GAGACCAGTGAGAAGGCAACTGG + Intronic
976885726 4:89981284-89981306 GGACACAGTGAGAAGGCAGCTGG + Intergenic
977906780 4:102485787-102485809 GAGGACAGAGAGAGGAAAGAAGG + Intergenic
978163998 4:105584979-105585001 GAGGAAAGTCAGAACAAAGCTGG - Intronic
980759249 4:137207402-137207424 GTGGAGAGTGAGAAGAAAGAAGG + Intergenic
981144600 4:141309826-141309848 GAGCAGAGAGAGCAGACAGCAGG + Intergenic
981827205 4:148956847-148956869 AAGGACATTAAGAAGAGAGCAGG - Intergenic
981875121 4:149532941-149532963 GAGGTCAGTGGGAAGACAGCAGG + Intergenic
982502314 4:156172435-156172457 GGACACAATGAGAAGACAGCTGG - Intergenic
985482299 5:121501-121523 GAGGAAAGTGAGAAAAGGGCAGG + Intergenic
985641298 5:1064622-1064644 GGGGACAGCGAGGAGACAGAGGG + Intronic
985989196 5:3541251-3541273 GAGGACAGTCTCATGACAGCGGG - Intergenic
986024690 5:3839641-3839663 GAGGCAAGACAGAAGACAGCAGG - Intergenic
986158529 5:5201172-5201194 GAGGACAGAGAGAGCACAGGAGG + Intronic
987004902 5:13700310-13700332 AAGGAGAGTGAGATAACAGCGGG - Intronic
987043477 5:14085104-14085126 GAGGACAATGAGAAGGAAGGAGG - Intergenic
987322178 5:16780504-16780526 GAGGTGAGTGGGACGACAGCTGG - Exonic
987849045 5:23325118-23325140 CAGGACAGTGAGATGACACATGG + Intergenic
991296195 5:65084254-65084276 GAAGACAATGAGAAGACATAGGG - Intergenic
991650581 5:68848360-68848382 AAGGACAGAGTGATGACAGCAGG + Intergenic
992417604 5:76566790-76566812 GAGGGCCATGAGAAGACAGCTGG + Intronic
992627474 5:78648624-78648646 GAGGAGAGCGAGAGGAGAGCGGG + Exonic
992689032 5:79225493-79225515 GAGGAAAATGAGAAGGAAGCTGG - Intronic
994690297 5:103010464-103010486 AAGTACACTGAGAAGACAGAAGG - Intronic
995552903 5:113298127-113298149 GAGGACAGTGAAAAGAAAAGTGG + Intronic
995794617 5:115928550-115928572 GAGCACAGGGAGGACACAGCTGG + Intergenic
997645262 5:135477619-135477641 GGGGAAAGTGAGAAGTTAGCCGG + Intergenic
997829394 5:137136736-137136758 AAGAGCAGTGTGAAGACAGCTGG - Intronic
998171028 5:139872109-139872131 GAGCAGGGTGAGAAGACAGCAGG + Intronic
998256220 5:140590967-140590989 GGTGAGAGTGAGCAGACAGCAGG + Intronic
998369654 5:141652668-141652690 GAGCACAGTGAGCAGACAGTGGG - Intergenic
998460054 5:142303296-142303318 GAGGACAGTCAAAAGAGAGTTGG - Intergenic
998481894 5:142469812-142469834 GCAGAGAGTGAGGAGACAGCAGG - Intergenic
998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG + Intronic
999293254 5:150441439-150441461 GAGGGCAGTGATAAAACAGCAGG + Intergenic
999452864 5:151691495-151691517 GAGGGCAGTGGGCAGGCAGCAGG - Intergenic
999486639 5:152003844-152003866 GAGGACAATATGAAGACATCAGG + Intergenic
999636600 5:153629397-153629419 GAAGAAAGTGAGAAGAAGGCAGG + Intronic
999902900 5:156105805-156105827 TAGGACTGTGAAAAGAAAGCAGG + Intronic
1001402813 5:171456040-171456062 GAGGAGAGAGAGGAGACAGCAGG - Intronic
1001535504 5:172495154-172495176 GAGGACAATGAGGATACAGTTGG + Intergenic
1002561553 5:180085459-180085481 GGGGACTGTGTGAAGGCAGCGGG + Intergenic
1002589684 5:180281781-180281803 GAGGACGGGGAGAAGACCGTGGG - Intronic
1002698258 5:181104468-181104490 GGATACAGTGAGAAGGCAGCTGG + Intergenic
1002708635 5:181180442-181180464 GGATACAGTGAGAAGGCAGCTGG - Intergenic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1003799296 6:9644456-9644478 GTTGACAGGGAGAAGACAACAGG + Intronic
1003799361 6:9645907-9645929 GTTGACAGGGAGAAGACAACAGG - Intronic
1004074159 6:12329880-12329902 GAACAGAGTGAGAAGACAGAGGG + Intergenic
1004333593 6:14743680-14743702 GAGGAGAGTGAGATGAGAGTGGG + Intergenic
1005565083 6:27083581-27083603 GACCACAGTGAGGAGACTGCTGG - Intergenic
1006547666 6:34792692-34792714 GAAAGCAGAGAGAAGACAGCTGG - Intronic
1006902247 6:37510758-37510780 GAGGAGACTGGGAGGACAGCTGG + Intergenic
1007228337 6:40330269-40330291 GAGGACAGTGAGAAGGCTGCTGG - Intergenic
1007876742 6:45111766-45111788 GACTACAGTGAGATGTCAGCTGG - Intronic
1009650161 6:66465696-66465718 GAGGTCAGAGACAAGAGAGCAGG - Intergenic
1009678171 6:66854649-66854671 GGGGAAAGTGAGAAGCCAGCAGG - Intergenic
1009947653 6:70358342-70358364 GAACACAGTGAGAAGGCAGCTGG + Intergenic
1010628304 6:78166566-78166588 GATTACAGGGAGAAGACAGCTGG - Intergenic
1011781899 6:90799023-90799045 GAGGATGGTGAGAAAACAGGAGG - Intergenic
1013160002 6:107533845-107533867 GAGGACACTGTGATCACAGCTGG + Intronic
1013429268 6:110041285-110041307 GAGATCACTGTGAAGACAGCTGG - Intergenic
1013801339 6:113948866-113948888 GAGTACAGTGTTAAAACAGCAGG + Intronic
1014697406 6:124640531-124640553 CAGGAAAGTGAGAAAACAGCAGG + Intronic
1016355789 6:143216808-143216830 GAGGACAGTGAGGGGAGAGGAGG + Intronic
1017355179 6:153496722-153496744 GAGGAAGGTGGGAAAACAGCTGG - Intergenic
1017797829 6:157863728-157863750 GGGGAAAGTGAGAAAACAGGTGG + Intronic
1017922274 6:158882870-158882892 GAAGGCAGTGAGAAGAGAGTGGG + Intronic
1018199246 6:161379973-161379995 TAGGGCAGTGAGAAGGCATCTGG - Intronic
1019994698 7:4716683-4716705 GAGGCCAGTGAGGGCACAGCAGG + Intronic
1021451584 7:20787159-20787181 GAGGACAGTGCGGAGACTGGAGG + Intergenic
1021577070 7:22114643-22114665 GAGTACAGTGAGGAGCCAGGCGG + Intergenic
1021667720 7:23002941-23002963 GAGGACAATGTGAAGACATAGGG - Intronic
1022750902 7:33224586-33224608 GAGGTGAGGGAGAAGACAGAAGG - Intronic
1023276316 7:38522502-38522524 GAGGGCAGAGAGAATGCAGCAGG + Intronic
1023982502 7:45078195-45078217 GAGGGCAGTGAGGGGACACCAGG + Intergenic
1024131784 7:46360834-46360856 GAGGACAGGAAGAAGCCAGGAGG + Intergenic
1024228410 7:47345971-47345993 GAGCACAGTGTGCAGTCAGCTGG - Intronic
1024601360 7:50984515-50984537 TAGGAAGGTGAGAAGACAACAGG - Intergenic
1026034640 7:66822258-66822280 GATGACAGGGAGATTACAGCTGG + Intergenic
1026099360 7:67371929-67371951 GACGTCAGGGAGAAGGCAGCCGG - Intergenic
1026984989 7:74549173-74549195 GATGACAGGGAGATTACAGCTGG - Intronic
1027688274 7:81306148-81306170 GATGACAGTGAAAAGACAATTGG - Intergenic
1029386775 7:100248576-100248598 GAGGCTTGTGAGATGACAGCAGG - Intronic
1029406190 7:100375153-100375175 GAGGACAGGGAGAGCACGGCTGG - Intronic
1029530529 7:101122299-101122321 GAGGTCAGAGAGAAGGGAGCAGG + Intergenic
1029549947 7:101232369-101232391 TGGGGCAGTGGGAAGACAGCGGG + Exonic
1030624562 7:111830588-111830610 GAGGTCTCTGAGAAGGCAGCAGG - Intronic
1030745059 7:113155213-113155235 CATACCAGTGAGAAGACAGCAGG - Intergenic
1031079385 7:117243386-117243408 GGGGAGAGGGAGAAAACAGCCGG - Intergenic
1031102766 7:117502685-117502707 GAGGCCAGTCTGAATACAGCAGG - Intronic
1031433638 7:121705451-121705473 TAGGACAGTGGGAAGAGAGGGGG + Intergenic
1031922650 7:127613098-127613120 GAGGACAGGGACAATGCAGCTGG + Intronic
1031972492 7:128074705-128074727 GAGGGCAGGGAGAGCACAGCTGG - Intronic
1032457681 7:132086239-132086261 GAGGACAGGAAGAAGAGAGAGGG + Intergenic
1032978219 7:137250348-137250370 GAAGACTGTGTGAAGACAGAGGG - Intronic
1034226754 7:149490536-149490558 CAGGGCAGTGAAAAGGCAGCAGG + Intronic
1034252887 7:149706511-149706533 GAGGAAAGGGAGAAGACAGGAGG - Intergenic
1034259877 7:149748346-149748368 GAGGATGGTGAGCTGACAGCTGG - Intergenic
1034759689 7:153659553-153659575 GACTACAGTGAAAAGGCAGCAGG - Intergenic
1034776423 7:153831464-153831486 GAGGTCAGTGAGGCTACAGCAGG + Intergenic
1035114268 7:156509716-156509738 GCGGGCAGTGAGAAGAGAGAGGG - Intergenic
1035810367 8:2486156-2486178 GTGGAGAGAGAGAGGACAGCAGG - Intergenic
1035821416 8:2596351-2596373 CAGGACGGTGAGCAGACAGCAGG - Intergenic
1037193390 8:16155419-16155441 GGGGGCAGAGAAAAGACAGCAGG + Intronic
1037400280 8:18489020-18489042 GAGGAGAGAGAGAAGAGAGAGGG + Intergenic
1039428042 8:37503105-37503127 GAAGACAGTGAGAGCTCAGCAGG - Intergenic
1039553650 8:38461151-38461173 TACTCCAGTGAGAAGACAGCAGG - Exonic
1039984678 8:42437259-42437281 GAGGACAGTGAGAAGCTGGTGGG - Exonic
1040292933 8:46134689-46134711 GGGGGAAGTGACAAGACAGCAGG - Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041873442 8:62661210-62661232 GTGGAAAGAGAGAAAACAGCAGG - Intronic
1042556683 8:70039284-70039306 GAGAACAGTGACAAGAGTGCAGG + Intergenic
1043679666 8:83007328-83007350 GAAGAGTGTGAGAAGACAGTGGG - Intergenic
1044962378 8:97543135-97543157 GAGGACAGAGAGACAACAGGTGG + Intergenic
1045316230 8:101046102-101046124 GAGGACAGTGTGAACAAAGAAGG + Intergenic
1046659475 8:116933703-116933725 GAGAACACTTAGAAGAGAGCAGG - Intergenic
1047327733 8:123855592-123855614 GGGTCCAGTGGGAAGACAGCCGG - Intronic
1047609993 8:126511643-126511665 CAGGACAGTGGGAAGAGAGGAGG - Intergenic
1048553235 8:135453433-135453455 GAGGACAGTGTGAAGGCAAAGGG + Intergenic
1049009032 8:139875178-139875200 GAGGAGAGAGACAAGGCAGCAGG + Intronic
1049570523 8:143368320-143368342 GCGGGCAGAGAGAAGAAAGCAGG + Intergenic
1051179012 9:14391131-14391153 AAGTATAGAGAGAAGACAGCAGG + Intronic
1053649531 9:40151044-40151066 AAGGCCAGTGAGCAGACAGAGGG + Intergenic
1053756218 9:41312840-41312862 AAGGCCAGTGAGCAGACAGAGGG - Intergenic
1054535050 9:66225129-66225151 AAGGCCAGTGAGCAGACAGAGGG - Intergenic
1054809665 9:69425054-69425076 GATGACGGTGGGAAGACAGCTGG - Intergenic
1055966308 9:81868419-81868441 GAGTACAGTCAGATGTCAGCTGG - Intergenic
1056953784 9:91066375-91066397 GATGAGATAGAGAAGACAGCTGG + Intergenic
1057091415 9:92261432-92261454 GATGACAGTGGGAAGGCAGGAGG + Intronic
1057949514 9:99358796-99358818 GGGGACAGTGAGGAGGGAGCAGG + Intergenic
1058542969 9:106031017-106031039 GAGGACTTTGAGCCGACAGCTGG + Intergenic
1058554313 9:106150265-106150287 GAGGACAGGGAAAAGGGAGCAGG - Intergenic
1058773719 9:108264140-108264162 GAGGACAGTGCGAAGTTAACAGG + Intergenic
1058847092 9:108971901-108971923 AGGGACAATGAGAAGACATCTGG - Intronic
1058945495 9:109851736-109851758 GAAGTGAGTCAGAAGACAGCAGG - Intronic
1059648599 9:116292952-116292974 GAGGACTGCAAGAAGACAGGAGG + Intronic
1059656801 9:116365060-116365082 GAGGAAAGCGAGGATACAGCTGG - Intronic
1060180405 9:121529789-121529811 CAGGAGAGTGAGAAGAAAGCTGG + Intergenic
1060283058 9:122226930-122226952 GAGGGCGGTGAGCAGACAGATGG + Exonic
1061743632 9:132724422-132724444 GAGGACACTGAGACCACAGAGGG - Intergenic
1062218378 9:135401372-135401394 GAAGACAGAGAGAGGAAAGCAGG + Intergenic
1202797275 9_KI270719v1_random:134296-134318 AAGGCCAGTGAGCAGACAGAGGG + Intergenic
1203689912 Un_GL000214v1:32573-32595 GAGGACACTGGAAACACAGCTGG - Intergenic
1203493116 Un_GL000224v1:125470-125492 AAGAACATTCAGAAGACAGCAGG - Intergenic
1203505736 Un_KI270741v1:67345-67367 AAGAACATTCAGAAGACAGCAGG - Intergenic
1203646363 Un_KI270751v1:71480-71502 GAGGACACTGGAAACACAGCTGG + Intergenic
1186200810 X:7153402-7153424 GAGGACAGGAGGAAGACAGGAGG - Intergenic
1186299299 X:8182269-8182291 GTATACAGTGAGAAGACAGGAGG + Intergenic
1186675121 X:11808414-11808436 AAGGACAGTGAGAAGAAGGAAGG + Intergenic
1187611340 X:20947156-20947178 TAGGACAGTGTGAAGATAGAGGG - Intergenic
1187699879 X:21955191-21955213 AAGGTTAGTGAGAAGAAAGCTGG + Intronic
1188516861 X:30997108-30997130 GAGGACAGAGAAAAGCCACCAGG - Intergenic
1188528751 X:31114443-31114465 GAAGAAAGTGAGAAGGCAGGAGG + Intronic
1189091889 X:38092328-38092350 GCGGAAAGAGAGAAGACAGTAGG + Intronic
1190286679 X:48966170-48966192 GAGGGCAGCAAGAAGACAGCAGG + Exonic
1190687451 X:52887688-52887710 GAGGGCAGAGAGAAGCCAGGTGG + Intergenic
1190698531 X:52968104-52968126 GAGGGCAGAGAGAAGCCAGGTGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1195129576 X:101839804-101839826 GAGGAGGTTGAGAAGACAGAAGG - Intronic
1195176663 X:102320025-102320047 GAGGAGGTTGAGAAGACAGAAGG + Intronic
1195182201 X:102367068-102367090 GAGGAGGTTGAGAAGACAGAAGG - Intronic
1195964162 X:110415075-110415097 GGGGAAACAGAGAAGACAGCAGG - Intronic
1196942645 X:120792583-120792605 GAGGAGAGTGAGATGAGAGCAGG - Intergenic
1197611331 X:128642355-128642377 GAGGATAGGGAGTAGAAAGCAGG + Intergenic
1197783621 X:130179534-130179556 GAGGTCAGTAGGAAGACAGCAGG - Intronic
1198429976 X:136555539-136555561 GAAGTCATTGAGAAGACAGAAGG + Intronic
1198929151 X:141834881-141834903 GGGGACAGTGAGGAGATATCTGG + Intergenic
1199600256 X:149537434-149537456 GAGAGGAGTGAGAAGGCAGCAGG + Intergenic
1199650328 X:149942506-149942528 GAGAGGAGTGAGAAGGCAGCAGG - Intergenic
1199724225 X:150565917-150565939 GAGGCCTGTGAGAAGATGGCTGG - Intergenic
1200034260 X:153318004-153318026 CAGGACACTGAAAACACAGCAGG + Intergenic
1200836711 Y:7739562-7739584 TAAGACAGTGAGGAGACAGGAGG + Intergenic
1200895905 Y:8375889-8375911 GAGGACACTGTGAAGACACAAGG + Intergenic
1201146456 Y:11067623-11067645 GAGGAGAGGGAGAGGACAGGAGG + Intergenic
1202060660 Y:20884569-20884591 AAGGCCAAAGAGAAGACAGCAGG - Intergenic
1202368479 Y:24182487-24182509 GAGGACAGTGAGAAGAAGAAAGG + Intergenic
1202502306 Y:25487630-25487652 GAGGACAGTGAGAAGAAGAAAGG - Intergenic