ID: 998586510

View in Genome Browser
Species Human (GRCh38)
Location 5:143432740-143432762
Sequence TGGAAGCCTTCATTTTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998586510 Original CRISPR TGGAAGCCTTCATTTTTATG AGG Intronic
906767874 1:48452111-48452133 TGGGAGCTTTCATTGTAATGGGG - Intronic
908692746 1:66801209-66801231 TGGAGCCCTTCATTTTGCTGAGG + Exonic
908797506 1:67845530-67845552 TGGAAGCGTTCTTTTTTCTATGG + Intergenic
911513777 1:98841931-98841953 TGGAAGGGTTGATTTTTCTGAGG + Intergenic
912925640 1:113910750-113910772 TGTAAGCCTACAATTTTAGGAGG - Intronic
917016952 1:170542920-170542942 TGCAAGTTTTAATTTTTATGTGG + Intronic
917512798 1:175682091-175682113 TGGATGCCTGCATTTTTCTCAGG - Intronic
917798792 1:178552033-178552055 AGAAAGCCTTCATTTTAAAGTGG + Intergenic
919894772 1:202002657-202002679 TGGAGGCTTGCATTTTAATGCGG + Intronic
920857453 1:209674960-209674982 AGAAAGCTTTCATTTTTATTCGG - Intergenic
921078408 1:211718911-211718933 TGGTAGCCTCCATTTTTATAAGG + Intergenic
921309420 1:213827935-213827957 TGGAAACCTTCATCATTTTGTGG - Intergenic
921421229 1:214951179-214951201 TTTAACCCTTCCTTTTTATGTGG + Intergenic
924848119 1:247793773-247793795 TGGAAGCCATCCTTTTTACATGG - Intergenic
1063521109 10:6742191-6742213 CGTAAGCCTTCATTTTCAGGTGG - Intergenic
1064210944 10:13360023-13360045 TGGAAGCCAGCATTTTCCTGTGG + Intergenic
1068237559 10:54258920-54258942 TGCATGCATTCATTTTTATCAGG - Intronic
1068706925 10:60087270-60087292 TGAAAGCCTCGGTTTTTATGTGG - Intronic
1069285072 10:66703742-66703764 TGGAATCCTTAATTTTTGTAGGG + Intronic
1069861482 10:71474315-71474337 TGGGAGGCTTCCTTTTTATTAGG + Intronic
1070712692 10:78694235-78694257 GAGAAGGTTTCATTTTTATGAGG - Intergenic
1071314663 10:84382899-84382921 GGTATGCCTTCATTTTCATGAGG + Intronic
1073329211 10:102659955-102659977 GGCAAGCCTTTATTTTTCTGAGG - Intergenic
1073997381 10:109331445-109331467 TGCAAGCCTTTTTTTTTATCTGG + Intergenic
1074342515 10:112647080-112647102 TGGAAGAGTTCATTTTCATCAGG + Intronic
1075110008 10:119571278-119571300 TGTAAGCCTTCACTCTTAAGTGG - Intergenic
1076180756 10:128405446-128405468 TGGGAGCCTTCATTATGAAGGGG - Intergenic
1076219367 10:128720749-128720771 TTGAATCCTTTATTTTAATGAGG + Intergenic
1079116685 11:17644585-17644607 TGGAAGCATTGAGTTTTGTGGGG + Intronic
1079827660 11:25218047-25218069 AGGAAGCATTCATTTTTAAATGG + Intergenic
1080757687 11:35217876-35217898 ATGAAGCTTTCATTTTGATGAGG + Intronic
1081420138 11:42866121-42866143 GGGAAGCCTTTGTTTTTCTGAGG - Intergenic
1086310906 11:85535889-85535911 TGGAATCCTACATTATTATGTGG - Intronic
1087341740 11:96915678-96915700 TGAAAGCATTCAGTTTTATAAGG + Intergenic
1088344719 11:108809970-108809992 TGCAACCCTTCTTTTATATGTGG + Intronic
1089015026 11:115158464-115158486 AGGAAGCTTACATTTTCATGGGG - Intergenic
1090558749 11:127905851-127905873 TGAAATTCTTCATTTTTATAAGG - Intergenic
1092643798 12:10547383-10547405 TGAAAACCTTCATTTCTGTGAGG + Intergenic
1093096237 12:14975219-14975241 TGGCATCCTTCATTTTTATCTGG - Intronic
1093853394 12:24068520-24068542 TAGAAGCCTTCATTTGCATATGG + Intergenic
1093861136 12:24169110-24169132 AGAGATCCTTCATTTTTATGTGG - Intergenic
1094048007 12:26188242-26188264 TGAATTCTTTCATTTTTATGTGG - Intronic
1095326479 12:40900368-40900390 AGGAAACCATCATTTTTAGGTGG + Intronic
1095548547 12:43403377-43403399 TGGAAGCCTTGTTTTTTTTTAGG + Intronic
1096544237 12:52326668-52326690 TGGAATTTTTCATTTTAATGTGG - Intergenic
1096552988 12:52385707-52385729 TGGATTTTTTCATTTTTATGGGG - Intergenic
1097572442 12:61351183-61351205 TGTAAACCTTTCTTTTTATGTGG - Intergenic
1099040512 12:77647789-77647811 TGGCAGGCTTTATTTTTCTGAGG - Intergenic
1099188068 12:79537297-79537319 TGGATGCAGTCATGTTTATGAGG - Intergenic
1099689302 12:85930884-85930906 TGTTGTCCTTCATTTTTATGTGG - Intergenic
1099728620 12:86468172-86468194 TAGTAGCCTTTATTTTTAGGTGG - Intronic
1102388502 12:112530913-112530935 TAAAAGCCTTCATTTTTGGGAGG + Intergenic
1103759600 12:123238937-123238959 TTGAAGCCTTCATATTTAGGGGG + Intronic
1107789205 13:43983822-43983844 TGGAAGCCATCATTTTGAGGGGG - Intergenic
1108109914 13:47058450-47058472 TGTAAGATTTCATTTGTATGAGG - Intergenic
1109436122 13:62305420-62305442 TCCAACCCTACATTTTTATGTGG + Intergenic
1110939321 13:81329722-81329744 TGGAAGTTATCATGTTTATGAGG - Intergenic
1111234715 13:85393939-85393961 TGGAACTCTACATTTTTATTTGG + Intergenic
1111304592 13:86390899-86390921 TGGAAGCCTTCTTTTAAATTAGG + Intergenic
1112143530 13:96672622-96672644 TTGACTCCTTCATTTTGATGGGG + Intronic
1112567436 13:100563436-100563458 TGGAATCCTTCACTTTTAAATGG + Intronic
1112956250 13:105062024-105062046 GAGAAGCATACATTTTTATGGGG - Intergenic
1113342082 13:109435921-109435943 TGGAAACCATCCTTTTTAAGTGG - Intergenic
1115400833 14:32958221-32958243 TGGAAGCATTCAGTTATTTGGGG - Intronic
1115649780 14:35394674-35394696 TGGAAGCTTTCATTTCTTAGAGG - Intergenic
1117561046 14:56938997-56939019 TAGAAGCCTTCAGTTTTGTAAGG - Intergenic
1117888343 14:60389395-60389417 TGTAAGCATTCAATTTTATTTGG - Intergenic
1118528913 14:66679180-66679202 TGGGTGCCTTCATTTTTAGATGG + Intronic
1119908678 14:78329502-78329524 TGGAAGCCTTCATTCTGGAGAGG - Intronic
1120831261 14:88999762-88999784 TGAAAGCCTCCATTTTTGTATGG + Intergenic
1120894340 14:89516323-89516345 TGGAAGCCTCCATTTCCATCTGG - Intronic
1124455688 15:29840642-29840664 AGGCAGCCTCCATCTTTATGTGG + Intronic
1125230432 15:37448921-37448943 TGGCACCAATCATTTTTATGGGG - Intergenic
1127158638 15:56155798-56155820 TGAAAGCCTTTTTTATTATGGGG - Intronic
1130606495 15:85321940-85321962 TGGAAGCCTTCATCTAAAAGTGG - Intergenic
1131212199 15:90507549-90507571 TGGAATCCACCATTTTTCTGTGG + Intergenic
1132248118 15:100313139-100313161 TGGAAGCTTTCATTTATTTTTGG - Intronic
1132348258 15:101121458-101121480 TAGCAGCCTTCATTTTGGTGGGG - Intergenic
1135711586 16:24721906-24721928 AGTATGACTTCATTTTTATGAGG + Intergenic
1135898745 16:26435118-26435140 GGGAATCATTCATTTTTATTGGG - Intergenic
1140230929 16:73116509-73116531 TGGAGGCCTCCATTTTGCTGAGG + Intergenic
1143948060 17:10611524-10611546 TGGAAGCTTCCATTTTCATGGGG - Intergenic
1145823188 17:27856343-27856365 TAGAAGTCTTCATTTTTTTATGG - Intronic
1153478864 18:5527108-5527130 TGGAAGTGTTCATTCTTAAGGGG + Intronic
1155277623 18:24204024-24204046 CTGATGCCTTCATTTTAATGGGG + Intronic
1156969911 18:43141503-43141525 GGGAATTCTTCATTTTTATCAGG + Intergenic
1158616656 18:58994095-58994117 TGGATGCTTTCATTTTTACATGG + Intergenic
1158805565 18:60967776-60967798 TGGAAGAATTCATTTTCTTGTGG - Intergenic
1158825387 18:61212827-61212849 TGGAAGACTTCAGGTTTTTGTGG + Intergenic
1160164549 18:76498269-76498291 TGGAGGCCTTTTTTTTTGTGGGG - Intergenic
1166929258 19:46291601-46291623 TGGAAGCCTTCATGTTTTTAGGG - Intergenic
1168483372 19:56740146-56740168 TGAAAGACTCCATTTTTATTTGG + Intergenic
1168699735 19:58430186-58430208 TGGCAGCATTCAGTTTTTTGTGG - Intergenic
926155741 2:10452998-10453020 TGGAGGAGTTCATTTTCATGGGG + Intergenic
926637241 2:15195304-15195326 TGGAACTCTTCCTTTTTATCAGG - Intronic
928048811 2:27967938-27967960 TGAAAGCATTCAGTTTTATAAGG + Intronic
929197665 2:39202752-39202774 TAGGAGCTTACATTTTTATGTGG + Intronic
930568869 2:53059331-53059353 CGGAAGTCTTTATTTTTATGAGG + Intergenic
930574715 2:53132363-53132385 CGGAAGTTTTCATTTTGATGAGG - Intergenic
933671442 2:85011324-85011346 TAGAATCCTTCATTTCTGTGAGG + Intronic
935338126 2:102035649-102035671 TGTAAGACTACATTTCTATGCGG - Intergenic
935600151 2:104914461-104914483 AGTAAGACTTCTTTTTTATGAGG + Intergenic
937555605 2:123151512-123151534 TGCAAGCCTTCAAATGTATGAGG - Intergenic
940071287 2:149690925-149690947 TGGCAGCATTCATTTTCTTGTGG + Intergenic
940191745 2:151047903-151047925 TGGAGGCATTCATCTTTGTGAGG + Intronic
941535717 2:166720365-166720387 AAGAAGCATTTATTTTTATGAGG - Intergenic
941717038 2:168775060-168775082 TGGAAGCAATCATTATTATGAGG + Exonic
945612924 2:212028780-212028802 TGAGAGCATTCATTTTTATATGG + Intronic
945729307 2:213513748-213513770 TGGTCCCCTTCATATTTATGAGG + Intronic
945890709 2:215427663-215427685 TGGAAACCATCCTTTATATGTGG - Intronic
946079024 2:217100971-217100993 TGTAATCATGCATTTTTATGGGG + Intergenic
947432828 2:230045657-230045679 TGGAAACCTTCTTCTTTATCTGG + Intronic
1170020597 20:11833194-11833216 TGCATGAGTTCATTTTTATGAGG + Intergenic
1170649201 20:18224510-18224532 TGGAAGCCTTAGTCTTTCTGGGG + Intergenic
1171116734 20:22531381-22531403 TGTAAGCCTTCCCTTTCATGTGG - Intergenic
1174436699 20:50511980-50512002 TGGCAGCCTTGATTTTCATGTGG + Intronic
1174775293 20:53338219-53338241 TAAAACCCTTCAATTTTATGTGG - Intronic
1174905935 20:54551387-54551409 CGGAAGTTTTCATTTTGATGAGG + Intronic
1175485150 20:59340469-59340491 TGGAAGACTTCCTTTTCATCAGG - Intergenic
1177015023 21:15776053-15776075 AGATAGCTTTCATTTTTATGAGG + Intronic
1178825158 21:36009220-36009242 TGGCAGAATTCATTTTTCTGTGG + Intergenic
1181367335 22:22388096-22388118 TGCAATCCTTCATATTTATTAGG + Intergenic
1181843145 22:25682438-25682460 GGGAAGCCTTGATTTCTCTGAGG + Intronic
1182404658 22:30115659-30115681 TAGAAGCCTACGTTCTTATGAGG + Intronic
1184311864 22:43650954-43650976 TAAAAGCATTCAGTTTTATGAGG + Intronic
1184485477 22:44776147-44776169 TGGATGCCTACATATTAATGAGG - Intronic
949217472 3:1587028-1587050 TTGAAGATTTCATTTTAATGTGG + Intergenic
950952796 3:17018344-17018366 TGTAAGCCTCCATTTGCATGAGG - Intronic
951049304 3:18076728-18076750 TTGATACTTTCATTTTTATGAGG + Intronic
951084491 3:18495196-18495218 TGGATGCCTGCATTTTTCTGAGG - Intergenic
951212634 3:19992618-19992640 AGGATATCTTCATTTTTATGTGG - Intronic
951350063 3:21595908-21595930 TCCAATCCTTCATTTCTATGTGG + Intronic
952997191 3:38896013-38896035 TGGAAGCATAGATATTTATGAGG - Intronic
953152200 3:40334691-40334713 TGGAATTCTGCATTTTTATATGG + Intergenic
954504383 3:51054962-51054984 TGGAAGCTTTCCTTATTATATGG + Intronic
955102891 3:55869372-55869394 TGAAAGCTGTCATTTGTATGAGG - Intronic
956506229 3:69943232-69943254 TGGATGCCTTGATTTTTTTGTGG - Intronic
958486093 3:94711509-94711531 TGGAAATCTTGGTTTTTATGTGG - Intergenic
960106489 3:113803178-113803200 TGTATGATTTCATTTTTATGTGG + Intronic
960260295 3:115560250-115560272 TGGAAGCCTGCATCTTTTGGGGG + Intergenic
960685317 3:120288583-120288605 TGGTAACCTGCATTTTTCTGGGG + Intergenic
964935319 3:162077374-162077396 CGTAAGCTTTCATTTTTCTGGGG + Intergenic
965712469 3:171569374-171569396 TAGGAGCCTTCAGTTTTATGGGG - Intergenic
965908127 3:173736050-173736072 TGGAAGACTTCATGTTTGGGAGG + Intronic
967064935 3:185906623-185906645 TGTAAGCACTCATTTCTATGGGG + Intergenic
969090430 4:4690003-4690025 TGGCAGCGTTCAGTTTCATGTGG - Intergenic
969409626 4:7019605-7019627 TGGGAGCCTGCATTCTCATGCGG + Intronic
970676097 4:18452069-18452091 TGGAATACTTCATTTTTACACGG + Intergenic
970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG + Intronic
971417359 4:26444387-26444409 TGGAAGCCTTGAGTTTTCTCAGG + Intergenic
974741871 4:66017442-66017464 TGCAAGATTTCACTTTTATGAGG + Intergenic
975277790 4:72521826-72521848 TGAAAGCATTCATTTATATGTGG - Intronic
975392130 4:73832868-73832890 TGGAATCCTTCATCTTTTTGGGG - Intergenic
975852507 4:78587191-78587213 TGGTAGCCTTAGTTTTTATTGGG + Intronic
977435756 4:96992117-96992139 TGGAAGTTTTAATTTCTATGTGG + Intergenic
977778873 4:100956768-100956790 TGGAAGACTTCAATGCTATGGGG + Intergenic
979194309 4:117901613-117901635 TGGGAGACTTAATTTTGATGGGG - Intergenic
980368548 4:131838348-131838370 TGAAAGCATTCAGTTTTATAAGG + Intergenic
980524128 4:133967534-133967556 TAGAAGTCTTCATTGTTCTGAGG - Intergenic
980651529 4:135722396-135722418 TGGATGCCTTAAATTTTTTGTGG + Intergenic
980825892 4:138072355-138072377 TGGAAAAGTTCATTTTTATCTGG + Intergenic
981689685 4:147493866-147493888 TTGAAGCCTTCAATGTTCTGGGG + Intronic
982637174 4:157911426-157911448 AGGAAACCTTCATTTTTCTCTGG + Intergenic
982873393 4:160613093-160613115 TGCAAGCTTACATTATTATGTGG + Intergenic
983768997 4:171524594-171524616 TGGAAGGCAACATTTTTAGGAGG + Intergenic
983811099 4:172063314-172063336 TGGTAGCCTTTAATTTTATGAGG - Intronic
985159887 4:187033736-187033758 TGAAAGCATTCAGTTTTATAAGG + Intergenic
986565834 5:9113000-9113022 TGGCAGCCTTCATTTCCTTGTGG - Intronic
986757235 5:10849541-10849563 AGGAAGCCTTTATCTTCATGTGG - Intergenic
986983335 5:13474136-13474158 TGCATGAGTTCATTTTTATGGGG - Intergenic
987269667 5:16293605-16293627 TGTAATCCTTCATTGTTTTGGGG + Intergenic
987531876 5:19131185-19131207 TGAAAGCATTCAATTTTATAAGG - Intergenic
988109252 5:26795727-26795749 TGTAAGCATTCTTTTTAATGTGG - Intergenic
988891885 5:35626477-35626499 TGGAAGCTTTCATTTTCCTAGGG + Intronic
988941275 5:36150973-36150995 TATAAATCTTCATTTTTATGAGG + Intronic
989173821 5:38500673-38500695 TTGATGCCTTCATCTTAATGAGG + Intronic
990093491 5:52083648-52083670 TAGAGGCCTTCAGTTTTATAAGG - Intergenic
992113084 5:73514472-73514494 TGTAAAGCTTCATTTTTACGAGG - Intergenic
992332996 5:75737075-75737097 TGGAATCCTTCTTTATCATGGGG + Intergenic
992775157 5:80082808-80082830 AGGAAGCCTTTATTTTCATGTGG + Intronic
993293742 5:86108680-86108702 TAAAAGCATTCATTTTTATAAGG + Intergenic
993465990 5:88248115-88248137 TGGGATCCTTGATTTTTATCTGG - Intronic
993654027 5:90556256-90556278 ATGCAGCTTTCATTTTTATGGGG + Intronic
993671147 5:90763448-90763470 TGGGACCCTTCATTTTGATGAGG + Exonic
994144466 5:96378074-96378096 TGCATGACTTCATTTATATGTGG + Intergenic
994516282 5:100776464-100776486 TGGAAGCATTTATTTATTTGTGG + Intergenic
994836602 5:104863015-104863037 TGGAATCCTTAATTCTTATAGGG + Intergenic
996909610 5:128640108-128640130 AGAAAGCCTTGATTTTCATGTGG - Intronic
997062203 5:130519883-130519905 TGCATGCCTGCATTTTTGTGTGG - Intergenic
998586510 5:143432740-143432762 TGGAAGCCTTCATTTTTATGAGG + Intronic
998943878 5:147315976-147315998 TGGAATAGTTCATTTTTGTGTGG - Intronic
1000518266 5:162267489-162267511 TGGATTTCTTCTTTTTTATGGGG - Intergenic
1001538745 5:172522155-172522177 AAGAAGCCTCAATTTTTATGTGG - Intergenic
1003180577 6:3788121-3788143 TACATGGCTTCATTTTTATGAGG - Intergenic
1003222442 6:4173162-4173184 TTGCAGCCTTCATTTGTATTTGG - Intergenic
1003946330 6:11079572-11079594 TGGAATTCTTCATCTTTTTGAGG + Intergenic
1007155192 6:39736182-39736204 TGTAAGCCTTCATTTATCTAGGG + Intergenic
1007333415 6:41132870-41132892 TGGAGGCCTTCTTTTATTTGAGG + Intergenic
1008396245 6:51010781-51010803 AGGAATCATTAATTTTTATGAGG + Intergenic
1009316157 6:62223615-62223637 TAAAAGCATTCATTTTTATAAGG - Intronic
1010184334 6:73125488-73125510 TGGATGCCTTCATTTCTTTATGG - Intronic
1011137117 6:84112559-84112581 TGGATTCATTGATTTTTATGAGG + Intergenic
1012015063 6:93839656-93839678 TGTATGCCTACATTTATATGAGG + Intergenic
1012129448 6:95472179-95472201 TGGAAGCCTTCATCTTAGAGGGG - Intergenic
1014567497 6:122968181-122968203 TGGAAGCTATGTTTTTTATGTGG + Intergenic
1017308915 6:152954079-152954101 TTGAAGCCTTTATTCTAATGAGG - Intergenic
1021497167 7:21288748-21288770 TGAAGGCTCTCATTTTTATGTGG + Intergenic
1022203618 7:28141572-28141594 AGGAAGCCTTCATTAGTATCAGG + Intronic
1022587765 7:31632000-31632022 TGGAAGCCTTCATTCCTAACAGG - Intronic
1023584592 7:41715998-41716020 TGGGAACCTTCATATTTACGAGG + Intergenic
1025472859 7:60878394-60878416 TGGAAGCCTTCATTTGAAATAGG - Intergenic
1025514147 7:61611472-61611494 TGGAAGCCTTCATTTGAAATAGG + Intergenic
1025538491 7:62040312-62040334 TGGAAGCCTTCATTTGAAATAGG + Intergenic
1025968986 7:66304402-66304424 TAGAAGCCATTATTTTTAAGAGG - Intronic
1025986921 7:66462113-66462135 TGGCAGAATTCATTTTCATGTGG - Intergenic
1026028098 7:66763325-66763347 TGGCAGAATTCATTTTCATGTGG + Intronic
1026383918 7:69826810-69826832 TGGAAGACTACATTTTTCTGGGG + Intronic
1026820378 7:73543827-73543849 TGGAAGGGTTCATTTTTCTGAGG - Intronic
1028680413 7:93522545-93522567 TGAAATACTTCATTTTTATAAGG - Intronic
1029461834 7:100698976-100698998 TGCGAGCCTTGATATTTATGTGG + Intergenic
1030529967 7:110699981-110700003 TGGAAGAATTCATTTCTTTGGGG - Intronic
1031665953 7:124482286-124482308 TGGAGGACTTCAGTTATATGAGG + Intergenic
1031870718 7:127087514-127087536 TGCAAGACTCCATTTATATGAGG + Intronic
1032491858 7:132329775-132329797 TGGGAGCCTTCATTTCTTTTTGG - Intronic
1032503661 7:132419154-132419176 TGGAAACCTTCCTCTTTAAGTGG + Intronic
1035362184 7:158320937-158320959 TGGTAGAATTGATTTTTATGTGG + Intronic
1036136439 8:6165942-6165964 TGGAAGAGTTCAGTTTTATTTGG - Intergenic
1036886242 8:12555793-12555815 TAAAGGCCTTCAGTTTTATGAGG - Intergenic
1037502804 8:19501450-19501472 TCAAAGCCTTCACTTTTCTGTGG + Intronic
1037913725 8:22759398-22759420 TGGTTGCTTTCATTATTATGGGG - Intronic
1038845298 8:31223286-31223308 TGGAAGGCATCAGTTTTAAGTGG + Intergenic
1038962147 8:32533036-32533058 TGGAAGCATTCTTTTTTTTTTGG - Intronic
1039223384 8:35360324-35360346 TAGAAGCTTTCATTTTTGTAGGG + Intronic
1041208255 8:55520728-55520750 AGAAAGCCTTCATTTTTCTACGG + Intronic
1041902545 8:62997856-62997878 TTGAAGTTTTTATTTTTATGAGG - Intronic
1042212610 8:66396257-66396279 AGCAAGCATTCATTTTCATGTGG + Intergenic
1042226410 8:66518354-66518376 TGGTATCTTTCATTTGTATGTGG + Exonic
1042842870 8:73141660-73141682 TGCAACCCTTCATTATTCTGAGG + Intergenic
1043674109 8:82927861-82927883 TGGTATGCATCATTTTTATGTGG - Intergenic
1044204857 8:89481578-89481600 TGAAATCATCCATTTTTATGGGG + Intergenic
1045244849 8:100434000-100434022 GGGAAGCCTTTATTTTTATGGGG + Intergenic
1045777566 8:105823777-105823799 TGAGAGTCTGCATTTTTATGCGG + Intergenic
1046073814 8:109291939-109291961 TGGAAGCCTTAATTTTTTTAAGG - Intronic
1047055370 8:121158402-121158424 TGGAAGCATTCACATTTCTGTGG + Intergenic
1047550888 8:125871175-125871197 TTGAACCCTGCATTTTTCTGAGG + Intergenic
1048671515 8:136728398-136728420 TGGCAGCATTCAGTTTTTTGTGG - Intergenic
1049962573 9:750684-750706 TGGAAGACTGGATTTTTCTGGGG - Intergenic
1050067415 9:1774718-1774740 TGGACCACTTCAGTTTTATGGGG - Intergenic
1050259075 9:3822066-3822088 TGGGAGACTTCATTTTTCTCGGG - Intergenic
1050277750 9:4017750-4017772 TGGAAGCATGTATTTTTAGGAGG - Intronic
1052154159 9:25162965-25162987 TGGATACCCTCATTTTTATAAGG - Intergenic
1052309633 9:27051652-27051674 TGTATGACTTCATTTATATGAGG - Intronic
1052604784 9:30685912-30685934 TGGTAGTCTTCATTTCTGTGTGG + Intergenic
1056274794 9:84983667-84983689 TGGAAATCTGAATTTTTATGGGG - Intronic
1056689664 9:88796722-88796744 TGGAAGCCTTAATTTTATTTAGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057737967 9:97683786-97683808 TGTAAGCCTTCCTTGTTGTGAGG - Intronic
1058206246 9:102112352-102112374 TGAAATCCTTCATTATTGTGTGG + Intergenic
1059480272 9:114583997-114584019 TGGAAGCTGTTATTTTTATCTGG - Intergenic
1060894963 9:127211579-127211601 TGGACGCCTTCATCTGTAGGTGG + Intronic
1186244025 X:7601462-7601484 TTGAAGTCTTCATATTTGTGAGG + Intergenic
1189318645 X:40073956-40073978 TGGGAGCCATCTTTTTCATGTGG + Exonic
1189884021 X:45521742-45521764 TGGAAGGATTCATTTTCTTGTGG + Intergenic
1190009692 X:46773800-46773822 TGCAAGACATCATTTGTATGAGG + Intergenic
1191638175 X:63400851-63400873 TGGCAGCATTCATGTATATGTGG - Intergenic
1194109622 X:89817518-89817540 TGGGAGGCTTCATTTTTTTTTGG - Intergenic
1195455900 X:105069343-105069365 TGCAAGCCTTCATTTGGATTTGG + Intronic
1196963292 X:121026923-121026945 TGGAATCCTTTATGTTTTTGAGG + Intergenic
1197458213 X:126704430-126704452 TTGACTCCTTCATTTTTATATGG - Intergenic
1198838246 X:140827862-140827884 TGGTAGCTTTTATTTTTAAGAGG + Intergenic
1199642611 X:149878362-149878384 TTGGACTCTTCATTTTTATGTGG - Intergenic
1201252287 Y:12071543-12071565 TGGTAGCACTCATTTTTATATGG + Intergenic