ID: 998591604 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:143485054-143485076 |
Sequence | GGCAAGAATCAGTCAGAATA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
998591600_998591604 | 15 | Left | 998591600 | 5:143485016-143485038 | CCCTTTGAGAGGTTTTTCAGGCT | No data | ||
Right | 998591604 | 5:143485054-143485076 | GGCAAGAATCAGTCAGAATATGG | No data | ||||
998591601_998591604 | 14 | Left | 998591601 | 5:143485017-143485039 | CCTTTGAGAGGTTTTTCAGGCTA | No data | ||
Right | 998591604 | 5:143485054-143485076 | GGCAAGAATCAGTCAGAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
998591604 | Original CRISPR | GGCAAGAATCAGTCAGAATA TGG | Intergenic | ||
No off target data available for this crispr |