ID: 998591604

View in Genome Browser
Species Human (GRCh38)
Location 5:143485054-143485076
Sequence GGCAAGAATCAGTCAGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998591600_998591604 15 Left 998591600 5:143485016-143485038 CCCTTTGAGAGGTTTTTCAGGCT No data
Right 998591604 5:143485054-143485076 GGCAAGAATCAGTCAGAATATGG No data
998591601_998591604 14 Left 998591601 5:143485017-143485039 CCTTTGAGAGGTTTTTCAGGCTA No data
Right 998591604 5:143485054-143485076 GGCAAGAATCAGTCAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998591604 Original CRISPR GGCAAGAATCAGTCAGAATA TGG Intergenic
No off target data available for this crispr