ID: 998594297

View in Genome Browser
Species Human (GRCh38)
Location 5:143512250-143512272
Sequence GTATGAACAAAGATTAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998594297_998594302 16 Left 998594297 5:143512250-143512272 CCTGGCTTAATCTTTGTTCATAC No data
Right 998594302 5:143512289-143512311 GTAATACTTTTTATGGGGTGTGG No data
998594297_998594303 17 Left 998594297 5:143512250-143512272 CCTGGCTTAATCTTTGTTCATAC No data
Right 998594303 5:143512290-143512312 TAATACTTTTTATGGGGTGTGGG No data
998594297_998594301 11 Left 998594297 5:143512250-143512272 CCTGGCTTAATCTTTGTTCATAC No data
Right 998594301 5:143512284-143512306 TGGAAGTAATACTTTTTATGGGG No data
998594297_998594299 9 Left 998594297 5:143512250-143512272 CCTGGCTTAATCTTTGTTCATAC No data
Right 998594299 5:143512282-143512304 CTTGGAAGTAATACTTTTTATGG No data
998594297_998594300 10 Left 998594297 5:143512250-143512272 CCTGGCTTAATCTTTGTTCATAC No data
Right 998594300 5:143512283-143512305 TTGGAAGTAATACTTTTTATGGG No data
998594297_998594304 18 Left 998594297 5:143512250-143512272 CCTGGCTTAATCTTTGTTCATAC No data
Right 998594304 5:143512291-143512313 AATACTTTTTATGGGGTGTGGGG No data
998594297_998594305 26 Left 998594297 5:143512250-143512272 CCTGGCTTAATCTTTGTTCATAC No data
Right 998594305 5:143512299-143512321 TTATGGGGTGTGGGGTGAAAAGG No data
998594297_998594298 -9 Left 998594297 5:143512250-143512272 CCTGGCTTAATCTTTGTTCATAC No data
Right 998594298 5:143512264-143512286 TGTTCATACTATACATATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998594297 Original CRISPR GTATGAACAAAGATTAAGCC AGG (reversed) Intergenic
No off target data available for this crispr