ID: 998596325

View in Genome Browser
Species Human (GRCh38)
Location 5:143534244-143534266
Sequence AATGGCTTATTGAATTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998596325_998596329 30 Left 998596325 5:143534244-143534266 CCTCCATAATTCAATAAGCCATT No data
Right 998596329 5:143534297-143534319 TTTTATTGCTTCTGTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998596325 Original CRISPR AATGGCTTATTGAATTATGG AGG (reversed) Intergenic
No off target data available for this crispr