ID: 998596329

View in Genome Browser
Species Human (GRCh38)
Location 5:143534297-143534319
Sequence TTTTATTGCTTCTGTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998596327_998596329 12 Left 998596327 5:143534262-143534284 CCATTTCCTTATAATAAATCTTA No data
Right 998596329 5:143534297-143534319 TTTTATTGCTTCTGTTTCTCTGG No data
998596326_998596329 27 Left 998596326 5:143534247-143534269 CCATAATTCAATAAGCCATTTCC No data
Right 998596329 5:143534297-143534319 TTTTATTGCTTCTGTTTCTCTGG No data
998596325_998596329 30 Left 998596325 5:143534244-143534266 CCTCCATAATTCAATAAGCCATT No data
Right 998596329 5:143534297-143534319 TTTTATTGCTTCTGTTTCTCTGG No data
998596328_998596329 6 Left 998596328 5:143534268-143534290 CCTTATAATAAATCTTATATATA No data
Right 998596329 5:143534297-143534319 TTTTATTGCTTCTGTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998596329 Original CRISPR TTTTATTGCTTCTGTTTCTC TGG Intergenic
No off target data available for this crispr