ID: 998601868

View in Genome Browser
Species Human (GRCh38)
Location 5:143592758-143592780
Sequence GGGCCAGGGCTCAACTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998601860_998601868 6 Left 998601860 5:143592729-143592751 CCTTCCCACAGTGGGAGAGGGCA No data
Right 998601868 5:143592758-143592780 GGGCCAGGGCTCAACTGCGCAGG No data
998601862_998601868 1 Left 998601862 5:143592734-143592756 CCACAGTGGGAGAGGGCAACTGA No data
Right 998601868 5:143592758-143592780 GGGCCAGGGCTCAACTGCGCAGG No data
998601855_998601868 16 Left 998601855 5:143592719-143592741 CCATCTGTCTCCTTCCCACAGTG No data
Right 998601868 5:143592758-143592780 GGGCCAGGGCTCAACTGCGCAGG No data
998601861_998601868 2 Left 998601861 5:143592733-143592755 CCCACAGTGGGAGAGGGCAACTG No data
Right 998601868 5:143592758-143592780 GGGCCAGGGCTCAACTGCGCAGG No data
998601854_998601868 17 Left 998601854 5:143592718-143592740 CCCATCTGTCTCCTTCCCACAGT No data
Right 998601868 5:143592758-143592780 GGGCCAGGGCTCAACTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998601868 Original CRISPR GGGCCAGGGCTCAACTGCGC AGG Intergenic
No off target data available for this crispr