ID: 998605527

View in Genome Browser
Species Human (GRCh38)
Location 5:143630529-143630551
Sequence ATTCCTGGTGCTATACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998605525_998605527 0 Left 998605525 5:143630506-143630528 CCTCGCTCACTATCAAAGTCAAA No data
Right 998605527 5:143630529-143630551 ATTCCTGGTGCTATACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998605527 Original CRISPR ATTCCTGGTGCTATACATTC TGG Intergenic
No off target data available for this crispr