ID: 998607561

View in Genome Browser
Species Human (GRCh38)
Location 5:143650466-143650488
Sequence CTCATCTACAACACACAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998607561_998607565 19 Left 998607561 5:143650466-143650488 CCAACTTGTGTGTTGTAGATGAG No data
Right 998607565 5:143650508-143650530 TGTAACTCCCTCTGTCTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998607561 Original CRISPR CTCATCTACAACACACAAGT TGG (reversed) Intergenic
No off target data available for this crispr