ID: 998611516

View in Genome Browser
Species Human (GRCh38)
Location 5:143694313-143694335
Sequence TTTAAAAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998611516_998611525 14 Left 998611516 5:143694313-143694335 CCCTCCTCCTCCTCCTTTTTAAA No data
Right 998611525 5:143694350-143694372 TTAAAGTTTGAAGGGTAATCTGG No data
998611516_998611526 15 Left 998611516 5:143694313-143694335 CCCTCCTCCTCCTCCTTTTTAAA No data
Right 998611526 5:143694351-143694373 TAAAGTTTGAAGGGTAATCTGGG No data
998611516_998611524 6 Left 998611516 5:143694313-143694335 CCCTCCTCCTCCTCCTTTTTAAA No data
Right 998611524 5:143694342-143694364 CCAACATTTTAAAGTTTGAAGGG No data
998611516_998611522 5 Left 998611516 5:143694313-143694335 CCCTCCTCCTCCTCCTTTTTAAA No data
Right 998611522 5:143694341-143694363 TCCAACATTTTAAAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998611516 Original CRISPR TTTAAAAAGGAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr