ID: 998612810

View in Genome Browser
Species Human (GRCh38)
Location 5:143707497-143707519
Sequence TGGGTTGTTACCTCATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998612806_998612810 -3 Left 998612806 5:143707477-143707499 CCCAGGACTGAGTATAGAGTTGG No data
Right 998612810 5:143707497-143707519 TGGGTTGTTACCTCATTTGAAGG No data
998612808_998612810 -4 Left 998612808 5:143707478-143707500 CCAGGACTGAGTATAGAGTTGGG No data
Right 998612810 5:143707497-143707519 TGGGTTGTTACCTCATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998612810 Original CRISPR TGGGTTGTTACCTCATTTGA AGG Intergenic
No off target data available for this crispr