ID: 998613354

View in Genome Browser
Species Human (GRCh38)
Location 5:143713031-143713053
Sequence CTAGATAATAAGATCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998613354_998613357 20 Left 998613354 5:143713031-143713053 CCACCTCTGATCTTATTATCTAG No data
Right 998613357 5:143713074-143713096 ATAAATTCTGCCTTTGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998613354 Original CRISPR CTAGATAATAAGATCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr