ID: 998620932

View in Genome Browser
Species Human (GRCh38)
Location 5:143793564-143793586
Sequence CCTGGTAAGCAGAAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998620932_998620936 8 Left 998620932 5:143793564-143793586 CCATTCTCCTTCTGCTTACCAGG No data
Right 998620936 5:143793595-143793617 GCCTGAGCACTCCCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998620932 Original CRISPR CCTGGTAAGCAGAAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr