ID: 998628020

View in Genome Browser
Species Human (GRCh38)
Location 5:143867543-143867565
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998628018_998628020 5 Left 998628018 5:143867515-143867537 CCGCATAAACATCAATTTCTATT No data
Right 998628020 5:143867543-143867565 CACTGCTGTCTCTAATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr