ID: 998630997

View in Genome Browser
Species Human (GRCh38)
Location 5:143898501-143898523
Sequence CTCAAATATTTGTAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998630997_998631003 19 Left 998630997 5:143898501-143898523 CCTTCCTTCTACAAATATTTGAG No data
Right 998631003 5:143898543-143898565 ACTGTTCTACAGGTGAATTTGGG No data
998630997_998631000 9 Left 998630997 5:143898501-143898523 CCTTCCTTCTACAAATATTTGAG No data
Right 998631000 5:143898533-143898555 TATGCCAGGCACTGTTCTACAGG No data
998630997_998630999 -5 Left 998630997 5:143898501-143898523 CCTTCCTTCTACAAATATTTGAG No data
Right 998630999 5:143898519-143898541 TTGAGTGTTTATTGTATGCCAGG No data
998630997_998631002 18 Left 998630997 5:143898501-143898523 CCTTCCTTCTACAAATATTTGAG No data
Right 998631002 5:143898542-143898564 CACTGTTCTACAGGTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998630997 Original CRISPR CTCAAATATTTGTAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr