ID: 998633920

View in Genome Browser
Species Human (GRCh38)
Location 5:143931481-143931503
Sequence AGGGAGAGCACAGAGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998633914_998633920 25 Left 998633914 5:143931433-143931455 CCCAGCAGTGGTGTTGCAGCACA No data
Right 998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG No data
998633913_998633920 26 Left 998633913 5:143931432-143931454 CCCCAGCAGTGGTGTTGCAGCAC No data
Right 998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG No data
998633915_998633920 24 Left 998633915 5:143931434-143931456 CCAGCAGTGGTGTTGCAGCACAG No data
Right 998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998633920 Original CRISPR AGGGAGAGCACAGAGACTGG AGG Intergenic
No off target data available for this crispr