ID: 998638851

View in Genome Browser
Species Human (GRCh38)
Location 5:143986928-143986950
Sequence GTTATTGTACAGATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998638851_998638855 24 Left 998638851 5:143986928-143986950 CCTTCCTCAATCTGTACAATAAC No data
Right 998638855 5:143986975-143986997 CTTTGCCTGTTTCTTTCCACTGG No data
998638851_998638856 25 Left 998638851 5:143986928-143986950 CCTTCCTCAATCTGTACAATAAC No data
Right 998638856 5:143986976-143986998 TTTGCCTGTTTCTTTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998638851 Original CRISPR GTTATTGTACAGATTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr