ID: 998639568

View in Genome Browser
Species Human (GRCh38)
Location 5:143994549-143994571
Sequence GTGACCACACAGTCATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998639567_998639568 -9 Left 998639567 5:143994535-143994557 CCGCAACTTCAGATGTGACCACA No data
Right 998639568 5:143994549-143994571 GTGACCACACAGTCATCACAAGG No data
998639565_998639568 19 Left 998639565 5:143994507-143994529 CCATGTACTTGATGATTTGGTCA No data
Right 998639568 5:143994549-143994571 GTGACCACACAGTCATCACAAGG No data
998639566_998639568 -6 Left 998639566 5:143994532-143994554 CCACCGCAACTTCAGATGTGACC No data
Right 998639568 5:143994549-143994571 GTGACCACACAGTCATCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998639568 Original CRISPR GTGACCACACAGTCATCACA AGG Intergenic
No off target data available for this crispr