ID: 998640651

View in Genome Browser
Species Human (GRCh38)
Location 5:144006757-144006779
Sequence TCCAGATGGCTTCACTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998640651_998640653 12 Left 998640651 5:144006757-144006779 CCAGAAGAGTGAAGCCATCTGGA No data
Right 998640653 5:144006792-144006814 AACCTATGATGTAGTTTAACAGG No data
998640651_998640655 17 Left 998640651 5:144006757-144006779 CCAGAAGAGTGAAGCCATCTGGA No data
Right 998640655 5:144006797-144006819 ATGATGTAGTTTAACAGGTGTGG No data
998640651_998640656 18 Left 998640651 5:144006757-144006779 CCAGAAGAGTGAAGCCATCTGGA No data
Right 998640656 5:144006798-144006820 TGATGTAGTTTAACAGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998640651 Original CRISPR TCCAGATGGCTTCACTCTTC TGG (reversed) Intergenic