ID: 998641624

View in Genome Browser
Species Human (GRCh38)
Location 5:144018288-144018310
Sequence TCCAGGCATCTGCCCACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998641620_998641624 7 Left 998641620 5:144018258-144018280 CCCTGCATGTGTCAAAATATCAG No data
Right 998641624 5:144018288-144018310 TCCAGGCATCTGCCCACTCTGGG No data
998641621_998641624 6 Left 998641621 5:144018259-144018281 CCTGCATGTGTCAAAATATCAGA No data
Right 998641624 5:144018288-144018310 TCCAGGCATCTGCCCACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998641624 Original CRISPR TCCAGGCATCTGCCCACTCT GGG Intergenic
No off target data available for this crispr