ID: 998648329

View in Genome Browser
Species Human (GRCh38)
Location 5:144089629-144089651
Sequence CTCTAATTCTCCAAGGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998648329_998648331 29 Left 998648329 5:144089629-144089651 CCACGTTCCTTGGAGAATTAGAG No data
Right 998648331 5:144089681-144089703 TGCACCCTGCTCAGATAAAATGG No data
998648329_998648332 30 Left 998648329 5:144089629-144089651 CCACGTTCCTTGGAGAATTAGAG No data
Right 998648332 5:144089682-144089704 GCACCCTGCTCAGATAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998648329 Original CRISPR CTCTAATTCTCCAAGGAACG TGG (reversed) Intergenic
No off target data available for this crispr