ID: 998648332

View in Genome Browser
Species Human (GRCh38)
Location 5:144089682-144089704
Sequence GCACCCTGCTCAGATAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998648330_998648332 23 Left 998648330 5:144089636-144089658 CCTTGGAGAATTAGAGCAAGCAG No data
Right 998648332 5:144089682-144089704 GCACCCTGCTCAGATAAAATGGG No data
998648329_998648332 30 Left 998648329 5:144089629-144089651 CCACGTTCCTTGGAGAATTAGAG No data
Right 998648332 5:144089682-144089704 GCACCCTGCTCAGATAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998648332 Original CRISPR GCACCCTGCTCAGATAAAAT GGG Intergenic
No off target data available for this crispr