ID: 998649655

View in Genome Browser
Species Human (GRCh38)
Location 5:144103814-144103836
Sequence CACAATCAGAAACTGCACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998649655_998649658 8 Left 998649655 5:144103814-144103836 CCTACGTGCAGTTTCTGATTGTG No data
Right 998649658 5:144103845-144103867 TTCTCTGATTGTGAAGGCAAAGG No data
998649655_998649657 2 Left 998649655 5:144103814-144103836 CCTACGTGCAGTTTCTGATTGTG No data
Right 998649657 5:144103839-144103861 ACTGGATTCTCTGATTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998649655 Original CRISPR CACAATCAGAAACTGCACGT AGG (reversed) Intergenic
No off target data available for this crispr