ID: 998652408

View in Genome Browser
Species Human (GRCh38)
Location 5:144135612-144135634
Sequence AACCAGAGCCTATTATAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998652408_998652411 5 Left 998652408 5:144135612-144135634 CCAAACTATAATAGGCTCTGGTT No data
Right 998652411 5:144135640-144135662 GATCTTAAATTGGATTCTTCTGG No data
998652408_998652410 -5 Left 998652408 5:144135612-144135634 CCAAACTATAATAGGCTCTGGTT No data
Right 998652410 5:144135630-144135652 TGGTTGGCAAGATCTTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998652408 Original CRISPR AACCAGAGCCTATTATAGTT TGG (reversed) Intergenic
No off target data available for this crispr