ID: 998656792

View in Genome Browser
Species Human (GRCh38)
Location 5:144190084-144190106
Sequence TAAGTGCCTGGCTGCGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998656792 Original CRISPR TAAGTGCCTGGCTGCGGGTG GGG (reversed) Intronic
900177270 1:1296393-1296415 TGAGGGCCAGGCTGGGGGTGGGG - Intronic
900532256 1:3160365-3160387 TCAGTCCCTGGCTGGGGGAGGGG + Intronic
902983638 1:20142442-20142464 TAGGTGCCAGGCTGGGCGTGTGG + Intronic
903215920 1:21843205-21843227 TAAGTGCCCGGCTGGGAGAGAGG + Intronic
903907806 1:26697833-26697855 GAAGGGCCTGGCCGGGGGTGAGG + Intronic
904698476 1:32344136-32344158 TATGTGTTTGGGTGCGGGTGGGG - Intergenic
904958208 1:34306512-34306534 TATGTGCGTGGGTGCTGGTGGGG - Intergenic
906508223 1:46395484-46395506 GAAGGGCCTGGCTGAGGGTTTGG + Intronic
906725160 1:48039273-48039295 GCAGTGCCTGTCTGCGGGCGGGG - Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
909119295 1:71580696-71580718 AAAGTGCCTGGCTCCTGGTAGGG - Intronic
911093942 1:94040459-94040481 TAAGTGTCTGGCTGCCGCTGGGG - Intronic
911266835 1:95753383-95753405 CAGCCGCCTGGCTGCGGGTGTGG + Intergenic
912305478 1:108561882-108561904 TAACTGCCTGGCGTCGGGGGTGG - Intronic
913319332 1:117577407-117577429 TCTGTGCCTGGCTGAGGCTGAGG + Intergenic
920126818 1:203700143-203700165 TAAGAGACTGGCTGAGGGTAGGG - Intronic
922530739 1:226343034-226343056 GATGTGCCTGGATGCGGGGGTGG + Intergenic
1068253187 10:54470384-54470406 GTGGTGCCTGGCTGCAGGTGGGG + Intronic
1076873832 10:133206413-133206435 CAAGGGCCTGACTGTGGGTGAGG + Intronic
1076995325 11:294841-294863 TGAGAGCCTGGCTGCAGGTGAGG - Exonic
1077470813 11:2759741-2759763 TAACTGTCTGGCTGGGGGAGAGG + Intronic
1080633870 11:34106111-34106133 GCAGTGCCTGGCTGCAGGTCTGG + Intronic
1081080173 11:38731744-38731766 TAAGAGCCTGACTGGGGCTGCGG + Intergenic
1083675269 11:64321649-64321671 TGGGTGCCAGGCTGCAGGTGAGG - Exonic
1083766124 11:64842410-64842432 GAGGTGCCTGGTTGGGGGTGAGG + Intronic
1083936120 11:65871031-65871053 TGAGTGTCTGGATGAGGGTGTGG + Intronic
1086137681 11:83458475-83458497 GAAGTGTCTGGTTGGGGGTGAGG - Exonic
1089023312 11:115241085-115241107 TAAATGGCTGGCAGGGGGTGGGG - Intronic
1089439704 11:118505106-118505128 TCAGTGGCTGGCTTCAGGTGGGG - Exonic
1091704624 12:2685504-2685526 TATGAGACAGGCTGCGGGTGAGG + Intronic
1091711194 12:2741841-2741863 TATGAGACAGGCTGCGGGTGAGG + Intergenic
1092306361 12:7304996-7305018 TCAGTGCCTGGCATGGGGTGAGG - Intronic
1093272129 12:17076563-17076585 TCAGTGCCTGTCTGGGGGTGGGG + Intergenic
1097249447 12:57624547-57624569 TTTGGGCCTGGCTGTGGGTGTGG + Intronic
1097679819 12:62637973-62637995 TAAGTCCCTGGTTGGGGGCGGGG + Intergenic
1099665873 12:85628574-85628596 TCAGGGCCTGTCTGAGGGTGGGG - Intergenic
1101792485 12:107940484-107940506 TAAGTGCATGTCTGTGTGTGGGG - Intergenic
1103804943 12:123565118-123565140 AAGATGCATGGCTGCGGGTGGGG - Intergenic
1103958263 12:124591820-124591842 TAAGTGCCTGGAAGAGAGTGAGG - Intergenic
1105027241 12:132857207-132857229 CACGTGCCTGGGTGCTGGTGTGG + Intronic
1106626625 13:31427275-31427297 GAAGAGCCTGGGTGTGGGTGTGG - Intergenic
1109828965 13:67761029-67761051 TATCTGCCTGGCTTCTGGTGAGG + Intergenic
1112155302 13:96810353-96810375 AATGTGCCTGGTTGGGGGTGGGG - Intronic
1112557452 13:100481624-100481646 TAAGTGACTGGTTGGTGGTGGGG + Intronic
1113448447 13:110388258-110388280 CAGCTGCCTGGCTGCGGCTGGGG - Intronic
1114454220 14:22845018-22845040 ACAGTGCCTGGCTGCTGGGGTGG - Intronic
1114683952 14:24510133-24510155 CACCTGCCTGGCTGAGGGTGAGG + Intergenic
1115763368 14:36597831-36597853 TAAATTCCTGGTTGGGGGTGGGG - Intergenic
1122262506 14:100531353-100531375 TGTGTGCCTGTCTGTGGGTGGGG + Intergenic
1122838000 14:104440458-104440480 TCAGGGCCTCGCTGGGGGTGAGG + Intergenic
1126678826 15:51184868-51184890 TAAGTGTCTGTCTGAGTGTGGGG + Intergenic
1129413555 15:75362523-75362545 TCAGTGTGTGGCTGAGGGTGAGG + Intronic
1129559626 15:76552744-76552766 GACGTTCCTGGCTGGGGGTGGGG - Intronic
1129692764 15:77723152-77723174 TCAGTGCCTGTCTGGGGGTGGGG - Intronic
1129755705 15:78097836-78097858 TCTGTGCCTGGGTGCAGGTGAGG - Intronic
1131095996 15:89654772-89654794 GAAGTGCCGGGCTGGCGGTGGGG - Intronic
1131266057 15:90916069-90916091 TCAGTGCCTGCTTGGGGGTGGGG + Intronic
1131427850 15:92361464-92361486 TGAGTGCCTGGCTGCGGTTTTGG + Intergenic
1132339175 15:101067209-101067231 TCAGTACCTGTCTGTGGGTGGGG + Intronic
1134235240 16:12459963-12459985 GAAGTGCCTGGCTCCCAGTGTGG + Intronic
1139482094 16:67236387-67236409 TAAGTGACTGCCAGCGGGTGGGG - Intronic
1147742976 17:42679254-42679276 TGAGGGCCTGGGTGGGGGTGGGG - Exonic
1148126702 17:45241082-45241104 CCAGTGCCGGGCTGCGGGTCGGG + Intronic
1148333108 17:46823836-46823858 TGAGTCCCTGGCTTCGGTTGTGG + Intronic
1148554802 17:48572035-48572057 TAAGAGGGTGGCTGCTGGTGTGG + Intronic
1148558902 17:48594794-48594816 AAACTGCCTAGCTGCGAGTGAGG - Intronic
1149557223 17:57582123-57582145 TCAGTGACTGCCAGCGGGTGTGG - Intronic
1150249755 17:63699233-63699255 TAAGTGCCCGGCTGGGTGGGAGG - Intronic
1151922123 17:77164701-77164723 TAATTGGGTGGGTGCGGGTGAGG + Intronic
1152238369 17:79149941-79149963 TAAGTGCCAGGGTGGGGATGGGG + Intronic
1152381014 17:79942275-79942297 TGAGTGCCAGGGTGCGAGTGAGG + Intronic
1158624807 18:59061865-59061887 CAGGTTCCTGGCTGCGGGAGAGG - Intergenic
1160810719 19:1011868-1011890 TGAGTGCCTCGGGGCGGGTGCGG - Intronic
1161228164 19:3157598-3157620 TATCTGCCTGGCTGGGGCTGAGG - Intronic
1167756828 19:51417883-51417905 TGGGGGCCTGGCTGGGGGTGGGG + Intergenic
925174079 2:1770196-1770218 AAAGAGCCTGGCAGCGAGTGAGG - Intergenic
925893410 2:8454065-8454087 TGAGTGCCGGGCAGCGGGTCAGG - Intergenic
927518894 2:23687632-23687654 CAAGGGCCTGGCTGTGGGGGAGG + Intronic
927606599 2:24491604-24491626 TGAGTGGCGGGCTGCGGGTGCGG + Intergenic
928373006 2:30754768-30754790 TAAGTGCCTGGCTTTGAGAGGGG - Intronic
931590349 2:63876180-63876202 TAGGTGCCTGGTAGAGGGTGTGG + Intronic
931972730 2:67607485-67607507 TGAGTGTCTGGCTGGGGCTGGGG - Intergenic
932098055 2:68869604-68869626 TAAGTGTCTGGCTCAGGGTGTGG - Intronic
933678104 2:85075913-85075935 TAAGAGCCTGACTATGGGTGAGG - Intergenic
937647671 2:124284111-124284133 TAAATGCCATGCTGAGGGTGAGG + Intronic
938124314 2:128660997-128661019 TAAGTGCCTTGCTGGGCGTGTGG + Intergenic
938225409 2:129611622-129611644 GATGTGCCTGCCTGAGGGTGTGG - Intergenic
938342637 2:130545872-130545894 TAAGAGCAGGCCTGCGGGTGCGG - Intronic
938347195 2:130574850-130574872 TAAGAGCAGGCCTGCGGGTGCGG + Intronic
938918423 2:135968453-135968475 TAAGTGCCTTCTTGCTGGTGGGG + Intronic
939565775 2:143784972-143784994 TAAGAGCCTGCTTGCTGGTGAGG - Intergenic
939678532 2:145102225-145102247 TAACTGCCTGGCTTCTGGTGGGG + Intergenic
943312199 2:186339958-186339980 TAAGTGGCTGCCTGCAGTTGGGG - Intergenic
943788733 2:191908248-191908270 TTAGTGACTGGCTGGGGGTGGGG - Intergenic
944381396 2:199114894-199114916 TAAGTGCTTGCCTGGGGCTGGGG + Intergenic
947488744 2:230575834-230575856 GAAGTGACAGGCTGGGGGTGTGG - Intergenic
948859211 2:240744837-240744859 TGAGTGCCAGGCCACGGGTGTGG - Intronic
948907053 2:240984621-240984643 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907066 2:240984703-240984725 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907082 2:240984799-240984821 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907102 2:240984922-240984944 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907110 2:240984974-240984996 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907118 2:240985026-240985048 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907130 2:240985105-240985127 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907142 2:240985178-240985200 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907151 2:240985233-240985255 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907163 2:240985306-240985328 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907184 2:240985434-240985456 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907193 2:240985489-240985511 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907230 2:240985732-240985754 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
1170020987 20:11836660-11836682 TGAGTGCATGGCAGCTGGTGGGG - Intergenic
1172113576 20:32561239-32561261 TTGGGGCCTGGTTGCGGGTGGGG + Intronic
1173821711 20:46023852-46023874 TAAGTGCCAGGCTCTGGGTCTGG - Intronic
1174046997 20:47740856-47740878 TCAGGGCTTGGCTGTGGGTGTGG - Intronic
1174417806 20:50379150-50379172 TACGTGCCTGGCTCAGGGTCGGG - Intergenic
1175883330 20:62273057-62273079 GAAGGGCCTGGCTCCGGGGGTGG + Intronic
1175940447 20:62535327-62535349 TCAGGGCCTTGCTGCTGGTGGGG + Intergenic
1176162221 20:63653649-63653671 CAAGCGCCTGGCTGCGGAAGGGG + Intergenic
1176305478 21:5120879-5120901 TAAGTGAGTGACTGTGGGTGGGG + Intronic
1179504646 21:41832593-41832615 TTAGTGCCTGGCTGGGAGGGAGG - Intronic
1179719530 21:43307337-43307359 TCCGAGCCTGGCTGCGGGTGGGG + Intergenic
1180708989 22:17826923-17826945 TCAGAGCCTGGCAGGGGGTGTGG + Intronic
1180965771 22:19787314-19787336 CCAGTGCCGGGCTGGGGGTGGGG - Exonic
1181047111 22:20220362-20220384 TAGGTGCCTGGTGGCGGGGGAGG - Intergenic
1181685615 22:24525801-24525823 TCAGTGCCTGCCTTGGGGTGAGG + Exonic
1181763111 22:25071651-25071673 GATGTGCCTGGCTGCGTGTTGGG + Intronic
1183623356 22:38987316-38987338 AAAGAGCCTGGCTGGGAGTGGGG - Intronic
1184653943 22:45931898-45931920 TGGGTTCCTGGCTGGGGGTGGGG - Intronic
1184882253 22:47315922-47315944 AAAGGGCCAGGCTGCAGGTGTGG - Intergenic
949143547 3:666092-666114 TAAATGTCTAGCTGGGGGTGTGG - Intergenic
950004455 3:9682827-9682849 TAAGTGCTGGGCTCCTGGTGTGG - Intronic
950924670 3:16728586-16728608 TAAGTCCCTGGGTGCCAGTGTGG - Intergenic
953908201 3:46878903-46878925 AAAAGGCCTGGCTGGGGGTGGGG - Intronic
954433529 3:50484003-50484025 TCAATGCCCAGCTGCGGGTGTGG + Intronic
954924570 3:54220996-54221018 TAGGTGGCTGGCTGGAGGTGAGG + Intronic
956757040 3:72398931-72398953 TAAGTGCCTGATTGTGGGGGAGG + Intronic
956894823 3:73648919-73648941 TGGGTGCCAGGCTGCAGGTGAGG - Intergenic
961052426 3:123758223-123758245 TAAGTGCCTGCCTGCTTATGGGG - Intronic
962738769 3:138348327-138348349 TAAGTGCTGGGCCGCGGGAGAGG + Intronic
962869934 3:139479832-139479854 TAAGTTCCTGGGTGCTGCTGCGG + Intronic
964205777 3:154173210-154173232 TACGTGGATGGCTGCAGGTGGGG - Intronic
964260715 3:154833273-154833295 TGAGTGCCTGGATGGGGGAGCGG - Intergenic
968437398 4:601035-601057 TTGCTGCCTGGCTGTGGGTGAGG - Intergenic
971975081 4:33673884-33673906 TAAGAGCTTGGCTCCGGGCGCGG - Intergenic
972641234 4:40926919-40926941 TAAGTGCCTGGCAGAGGGGAGGG + Intronic
972676843 4:41268206-41268228 TAAGTGCCTGGGTGTGGCTGAGG - Exonic
973588924 4:52420583-52420605 TAAGGGCCAGGCTCCAGGTGAGG + Intergenic
976774998 4:88698139-88698161 GAAGGGCCTGGATGGGGGTGAGG - Exonic
978289541 4:107120777-107120799 TGACAGCCTGGCTGGGGGTGGGG + Intronic
979729602 4:124008539-124008561 TCAGGGCCTGTCTGGGGGTGGGG - Intergenic
984498675 4:180531463-180531485 CAAGGGGCTGGCTGCAGGTGAGG - Intergenic
985932823 5:3072490-3072512 TCAGGGCCTGGCTTCTGGTGAGG - Intergenic
986231080 5:5865211-5865233 TCAGTGCCTAGCTGAGGATGAGG - Intergenic
986709524 5:10478465-10478487 TAAGGCTCTGGCTGGGGGTGGGG + Intergenic
989102273 5:37834572-37834594 TGCGGGGCTGGCTGCGGGTGGGG + Intronic
993550918 5:89272874-89272896 TAAGTGCAATGCTGGGGGTGTGG - Intergenic
997634901 5:135398284-135398306 AAAGAGCCTCGCTGGGGGTGGGG - Intronic
998414120 5:141933189-141933211 TAGGTACCTGGCTGAGGGTGTGG + Intronic
998426746 5:142035284-142035306 TCTGTGCCTGGCTGTGGGTGGGG + Intergenic
998656792 5:144190084-144190106 TAAGTGCCTGGCTGCGGGTGGGG - Intronic
999161220 5:149500714-149500736 ACAGTGCCTGGCTGCTTGTGTGG + Intronic
1001455865 5:171859142-171859164 TGGGTGCCAGGCTGCTGGTGAGG - Intergenic
1002639366 5:180623444-180623466 GAAGTGCCCAGCTGGGGGTGGGG - Intronic
1007281921 6:40719279-40719301 TAAGTGTGTGTCTGGGGGTGAGG + Intergenic
1007631058 6:43273999-43274021 TAAGTGCCTGAATGAGTGTGGGG + Intronic
1018702722 6:166439932-166439954 AAAGGGGCTGGCTGCAGGTGTGG + Intronic
1019137790 6:169922140-169922162 ACAGTGCCAGGCTGCTGGTGGGG + Intergenic
1020154908 7:5714953-5714975 TAAGTGCCTCTTTGAGGGTGAGG - Intronic
1022550853 7:31237657-31237679 TATGGGCCTGTCTGAGGGTGTGG - Intergenic
1023171588 7:37394760-37394782 TAAGTGCATGGCAGTGGGGGTGG + Intronic
1025622826 7:63189967-63189989 TAAGTGATTGGCTCGGGGTGTGG - Intergenic
1026095462 7:67342966-67342988 TGTGTGCCTGGATGTGGGTGTGG - Intergenic
1026639684 7:72113383-72113405 CAATTGCTTGGCTGCTGGTGAGG - Intronic
1027906170 7:84185379-84185401 TAAGGGGCTGGGTGTGGGTGTGG + Intronic
1029735799 7:102465162-102465184 TAAGAGCCGGGCAGCGGGTGAGG + Intronic
1032016216 7:128381821-128381843 TGAGGGCCTGGCGGGGGGTGGGG - Intergenic
1034763055 7:153691682-153691704 TAAGTGCCCGGCTCAGAGTGAGG - Intergenic
1034963962 7:155380214-155380236 TCATTGCCTGGCTGCCTGTGGGG + Intergenic
1035425320 7:158767587-158767609 GACCTGCCTGCCTGCGGGTGTGG - Intronic
1039433835 8:37546053-37546075 TCAGTGCCAGGCTGCAGGGGTGG + Intergenic
1040047803 8:42980976-42980998 TAAGAGCCTGCCTGCTGGTGGGG - Intronic
1041346521 8:56904428-56904450 TATGTGCCAGGCTGCGTGTCAGG + Intergenic
1042218298 8:66449193-66449215 TATGTCCCTGGCTGTGGCTGGGG - Intronic
1042250329 8:66750375-66750397 TAGGTGCCTGGCTCAGGCTGGGG - Intronic
1045330675 8:101153316-101153338 GAAGAGCCTGTCTGAGGGTGCGG - Intergenic
1045776964 8:105815983-105816005 TTAGTGGGTGGCTGGGGGTGGGG - Intergenic
1046759596 8:118007591-118007613 TAAGTTCCTGGATGCATGTGTGG - Intronic
1049245910 8:141562419-141562441 TATTTGCCTGGCAGCGGGGGCGG + Intergenic
1049621294 8:143599466-143599488 CAAGTGCCTGGCTCCGGAGGAGG + Exonic
1049624694 8:143614757-143614779 GCAGGGCCTGGCTGTGGGTGGGG - Intronic
1053540414 9:38968040-38968062 TTGGTGCCGGGCGGCGGGTGGGG - Intergenic
1053804763 9:41790198-41790220 TTGGTGCCGGGCGGCGGGTGGGG - Intergenic
1054625726 9:67395883-67395905 TTGGTGCCGGGCGGCGGGTGGGG + Intergenic
1056163676 9:83921949-83921971 TTAGTGGCTGGCTGGGGTTGTGG - Intergenic
1059615408 9:115945272-115945294 TAAGTGCCTGGCTGGGTGCCTGG - Intergenic
1061826593 9:133261809-133261831 CAATTGCGTGGCTGGGGGTGGGG - Intronic
1061862502 9:133475267-133475289 CAAGTGCCTGGGTTGGGGTGGGG - Intronic
1062052739 9:134455942-134455964 TAGGTGCCTGGGTCCAGGTGAGG + Intergenic
1187230725 X:17420314-17420336 TAAGTGCATGGGTGCAGGGGTGG - Intronic
1189121723 X:38402229-38402251 AAAGTGGCTGTCTGTGGGTGTGG + Intronic
1190066845 X:47247421-47247443 TATGTGCCAGGCTGTGGGTGGGG + Intronic
1194207921 X:91033937-91033959 CCAGTGCCTGTCTGGGGGTGGGG - Intergenic
1197972300 X:132127941-132127963 GGAATGCCTGGCTGGGGGTGGGG - Exonic
1200133299 X:153862943-153862965 CAGGAGCCTGGCTGGGGGTGAGG + Intronic
1200248680 X:154540752-154540774 TAACTGCCTGGCTCTGGGTGAGG - Intronic
1200256495 X:154585587-154585609 TAAGTGGTTGGGTGGGGGTGGGG + Intronic
1200261274 X:154618816-154618838 TAAGTGGTTGGGTGGGGGTGGGG - Intronic
1200883142 Y:8241382-8241404 GAAGTGCCTGGTAGAGGGTGTGG - Intergenic