ID: 998657799

View in Genome Browser
Species Human (GRCh38)
Location 5:144201629-144201651
Sequence TTTTTATTGCCACCATACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998657796_998657799 4 Left 998657796 5:144201602-144201624 CCACGCAACACACCTGCGAGGCA 0: 1
1: 0
2: 0
3: 7
4: 143
Right 998657799 5:144201629-144201651 TTTTTATTGCCACCATACCCTGG 0: 1
1: 0
2: 0
3: 18
4: 155
998657798_998657799 -8 Left 998657798 5:144201614-144201636 CCTGCGAGGCAGGTCTTTTTATT 0: 1
1: 0
2: 2
3: 32
4: 291
Right 998657799 5:144201629-144201651 TTTTTATTGCCACCATACCCTGG 0: 1
1: 0
2: 0
3: 18
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998657799 Original CRISPR TTTTTATTGCCACCATACCC TGG Intronic
900903348 1:5532544-5532566 TTTTTCTTGCCTCCTTACTCAGG - Intergenic
901529459 1:9844044-9844066 TTTCTTTTGCCTCCATGCCCAGG - Intergenic
903047678 1:20576454-20576476 TTCTTCATGCCACCACACCCAGG + Intergenic
903155276 1:21438603-21438625 TTGTTATTGCCACTATATGCTGG + Intergenic
903414025 1:23168986-23169008 TTTTTATTGCCTCCGTAGCTGGG + Exonic
905138707 1:35822920-35822942 TTTCTTTTGCCATCATACCCAGG - Exonic
907461934 1:54610291-54610313 GGTTTATTTACACCATACCCTGG - Intronic
908887913 1:68811064-68811086 TTTTTATGAGCACCATACCTTGG - Intergenic
911429655 1:97767931-97767953 TTTTTCCTGCCAACATACCAAGG + Intronic
912094937 1:106127780-106127802 TTTTTATTGTCACCATTAGCTGG - Intergenic
912220145 1:107664912-107664934 TCTTTCTTGCCACTATACCTTGG - Intronic
913114975 1:115688685-115688707 TTTTTATTTCCCACATACTCGGG + Intronic
915695943 1:157741575-157741597 TTTTTATTGCTAACATTCCATGG + Intergenic
916094511 1:161337070-161337092 TTTTTTTTGCCATCTTGCCCAGG + Intronic
916844083 1:168630580-168630602 TTTTTATCCCCCCCATAACCAGG + Intergenic
918916794 1:190651055-190651077 TTTTTATTTCCAAATTACCCTGG - Intergenic
920025096 1:202988385-202988407 TTTTTCTGGCCAAAATACCCTGG + Intergenic
920124862 1:203686021-203686043 TAGATATTGCCACCTTACCCAGG - Intronic
922846809 1:228692382-228692404 TCTTATTTGCCACCATGCCCTGG + Intergenic
1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG + Intergenic
1068794448 10:61063118-61063140 TTGTCATTGCCACCAAATCCTGG - Intergenic
1070266219 10:74905753-74905775 TTTTTATTATCACCCTACACCGG - Intronic
1071742484 10:88375919-88375941 CTTGTGTTGCCACCATCCCCTGG - Intronic
1072994524 10:100231147-100231169 TTTTAAATGCCCCCATTCCCAGG + Intergenic
1077817937 11:5706290-5706312 TATTTATTCCCACCATATCCAGG + Intronic
1078905163 11:15678798-15678820 TTTTTATTGCCACATTTCACTGG - Intergenic
1084842157 11:71863188-71863210 TTGTTCTTGCCACCATGCCTAGG - Intergenic
1085730553 11:78994860-78994882 TGTTCATTTCCACCATTCCCCGG + Intronic
1086656477 11:89363153-89363175 TTTTTGTTACCAGCATATCCAGG - Intronic
1087388910 11:97509581-97509603 TTATTATTGCAAACATACACAGG + Intergenic
1087906455 11:103703384-103703406 CTGTTATTGCCACCAGGCCCAGG + Intergenic
1088258967 11:107927418-107927440 TTTTTTTTGCCACTGTCCCCAGG + Intronic
1088306849 11:108419901-108419923 TTTTTCTTGCCATTATACACTGG - Intronic
1088459734 11:110069865-110069887 TTTTTATGGACTCCATGCCCTGG - Intergenic
1089618999 11:119711891-119711913 TTTTTATTGTCACCCTGCACAGG + Intronic
1093816150 12:23550098-23550120 TTTAGATTCCCACCATAGCCTGG - Intronic
1094114651 12:26897520-26897542 TTTCTATTCCCACCATTCCATGG + Intergenic
1095467591 12:42504252-42504274 CTTTTCTTGGCACCATGCCCAGG - Intronic
1095798288 12:46244997-46245019 TTTTTATGCCCACCATCACCTGG + Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1096003753 12:48151647-48151669 TTTCTATGGCCACCATGCTCTGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097892360 12:64790832-64790854 GTTTTAGTGCCACCAAACTCAGG - Intronic
1101569875 12:105943910-105943932 TCTGTATTGCCATCATTCCCAGG - Intergenic
1103757615 12:123221886-123221908 TTTTTATTTCCAGCATATACAGG - Exonic
1106066436 13:26356234-26356256 TTTTTATTGTCACTATATGCTGG + Intronic
1108882514 13:55137885-55137907 CTTTTCTTGCCTCCATTCCCAGG + Intergenic
1109341070 13:61059770-61059792 TTTTTATTCTCACCATGCACAGG - Intergenic
1111093780 13:83482500-83482522 TTTTTATTGACACTCTACCCAGG - Intergenic
1111182088 13:84682835-84682857 TTTTTGTTATCACCATACACTGG - Intergenic
1115786496 14:36832193-36832215 TTTTGATTTCCACTATACTCTGG - Intronic
1121935001 14:98010335-98010357 TTTTTTTTCCCTCCATTCCCGGG - Intergenic
1126178652 15:45763376-45763398 TTTTAATTGCCTTCATAACCTGG - Intergenic
1127243757 15:57148687-57148709 TTTTTTTTGCCACGTCACCCAGG - Intronic
1128592423 15:68912456-68912478 TTTTTATTGTCACTACTCCCTGG - Intronic
1129427322 15:75473171-75473193 TATTCATCTCCACCATACCCGGG + Intronic
1132125968 15:99224929-99224951 TTTTTATTGCCTCTAGACACAGG + Intronic
1138613749 16:58147938-58147960 GTTCAATTGCCACCATACCAAGG - Intergenic
1138788980 16:59879878-59879900 TTTTTATTGACTCTATACACTGG + Intergenic
1139080868 16:63519175-63519197 TTTTTTTTGCCCACATAACCTGG + Intergenic
1140820316 16:78657233-78657255 TTTTCATTGCCACCCTTGCCTGG + Intronic
1141329111 16:83091998-83092020 TTTTTAATGCCAGCATTGCCTGG - Intronic
1150458370 17:65326652-65326674 TTTTTAATGCCACCACAACGGGG - Intergenic
1151781958 17:76252687-76252709 TTTTTTTTTTCACTATACCCGGG + Intergenic
1151944404 17:77311630-77311652 ATTTAACTGCCACCATCCCCAGG + Intronic
1155737998 18:29248320-29248342 TTTATATTTCCACTATAGCCTGG - Intergenic
1158638316 18:59180528-59180550 TTTCTATTGGCACCAGCCCCAGG + Intergenic
1159072987 18:63646784-63646806 TTTTTCTTCCCTCCATTCCCAGG - Intronic
1159090696 18:63845490-63845512 TTTTTTCTGCCACAATACACAGG - Intergenic
1160122010 18:76139166-76139188 TTTGTGTAACCACCATACCCCGG + Intergenic
1164229606 19:23275903-23275925 CTTTTGCTGCCACCATCCCCAGG + Intergenic
1164685011 19:30160822-30160844 TTTTTATTTCCCCAAGACCCTGG + Intergenic
1166903392 19:46085027-46085049 TATTTACTGCCAACATACCATGG + Intergenic
1167083433 19:47292819-47292841 ATATAATTGCCAGCATACCCAGG - Intronic
927138676 2:20115151-20115173 GTTCAATTGCTACCATACCCTGG - Intergenic
928339729 2:30432132-30432154 TCTTTCCTGCCACCATTCCCAGG + Intergenic
930106656 2:47645595-47645617 TTTTTATGGGCACCATGCACTGG + Intergenic
931533497 2:63245048-63245070 TTTTTATTGCCACCTGTCACAGG - Intronic
932969672 2:76525270-76525292 TTTCTATTGTCATAATACCCAGG - Intergenic
935026424 2:99281602-99281624 TTGTTATTGCTACAATGCCCGGG - Intronic
935051582 2:99529324-99529346 TATTTAGTGGCACCATCCCCTGG + Intergenic
937437164 2:121890116-121890138 CTTTTGCTGCCACCAAACCCAGG - Intergenic
940074665 2:149727855-149727877 ATTTTAATGCCATCATGCCCTGG + Intergenic
940604694 2:155905972-155905994 TTCTTATTGCCTCCATCCTCAGG + Intergenic
941588175 2:167385433-167385455 TTTTTATAACCACCACTCCCTGG + Intergenic
943763867 2:191639211-191639233 ATTTTATTGCCACAATAGCATGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944856216 2:203769829-203769851 TTTTTTTTCCCACCATAACCAGG + Intergenic
945887024 2:215386469-215386491 TCTTTACTGCCACCACGCCCGGG + Intronic
947349018 2:229223176-229223198 ATTCCATTGCCACCATACCAAGG + Intronic
1169447469 20:5684459-5684481 TTTTTATTGCCAGCAAAGCCAGG - Intergenic
1169637454 20:7708059-7708081 TTTTTATTCCCACCATAGCATGG + Intergenic
1173173351 20:40744766-40744788 TTTTTATTGGAAGCAAACCCTGG - Intergenic
1177184759 21:17781000-17781022 TATTTTTTGGCACCATATCCTGG - Intergenic
1177381359 21:20348300-20348322 TTTTTATTTCTTCTATACCCAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1182878412 22:33712205-33712227 TTTTTTTTTCCCCCATCCCCAGG - Intronic
951669794 3:25167863-25167885 TTTTTCTTTCCACCCTACCCTGG + Intergenic
955984680 3:64560298-64560320 TTTTTATTCCCACCAGACAGTGG - Intronic
956634792 3:71353083-71353105 TTTTTAATGCCAGCTTTCCCAGG - Intronic
959197350 3:103201480-103201502 TTTTTAGTCCCACCTTGCCCAGG - Intergenic
961456133 3:127024857-127024879 TTGTTTTTGCCACCATATCTGGG + Intronic
964454017 3:156840932-156840954 TTTTATTTTCCACCATACCTAGG - Intronic
964609274 3:158593836-158593858 ATTTTGTTGCCACCTTGCCCAGG + Intronic
964992281 3:162828727-162828749 TTTTCATAGCCACCATAGCTGGG - Intergenic
969783265 4:9429231-9429253 TTGTTCTTGCCACCATGCCTAGG - Intergenic
972560573 4:40224579-40224601 TTTTTATTATCACCATGCGCTGG + Intronic
973209922 4:47604390-47604412 TTTTAAATCCCACCATACGCTGG + Intronic
974310194 4:60196782-60196804 TTTTCTTTCCCACTATACCCTGG - Intergenic
974632309 4:64509416-64509438 TTTTTTTTGCCACCAAATACTGG + Intergenic
975129093 4:70814640-70814662 TCTTTATTTCCATCATAACCAGG + Intergenic
975545270 4:75554541-75554563 TTTTTTTTTCCATGATACCCAGG + Intergenic
977202931 4:94138273-94138295 TTTTTCTTGCCAGATTACCCTGG - Intergenic
977532994 4:98221774-98221796 TTTTTATTTCCACTGTAGCCTGG - Intergenic
978340296 4:107715379-107715401 CTTTTATTTCCCCCATCCCCAGG - Intronic
980294703 4:130896887-130896909 TGTTTCTTTCCACCATAGCCTGG + Intergenic
980749710 4:137072307-137072329 TTTTCATTATCTCCATACCCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988327579 5:29789638-29789660 CTTTTTTTGTCACCATACCAAGG + Intergenic
989681844 5:44039048-44039070 TTTTTATTGCCAGATTGCCCTGG + Intergenic
991345196 5:65658321-65658343 TTTTAAATGCCACCACACCTTGG + Intronic
994504922 5:100630209-100630231 TTTCTATTGCCTGAATACCCTGG - Intergenic
995703425 5:114960819-114960841 TTTTAATTAACAACATACCCTGG + Intergenic
995887799 5:116915837-116915859 TTTTCCTTGCCTCCATACTCAGG - Intergenic
997536818 5:134628973-134628995 AGTTTCTTGCTACCATACCCAGG - Intronic
998657799 5:144201629-144201651 TTTTTATTGCCACCATACCCTGG + Intronic
999335243 5:150710372-150710394 TCAATATTGCCACAATACCCAGG - Intronic
1000458764 5:161485910-161485932 TTTTTGTTGCCTTCATTCCCAGG - Intronic
1004411494 6:15385299-15385321 CTTTAAGTGCCCCCATACCCTGG + Intronic
1007747436 6:44051607-44051629 CTTTTGCTGCCACCAGACCCAGG + Intergenic
1008108278 6:47464221-47464243 TTTCTATTGCCAGATTACCCAGG - Intergenic
1009404461 6:63294400-63294422 TTTTTATTGTAACCATATGCTGG + Intronic
1010309420 6:74366308-74366330 TCTTTATTGCCAACTTACACAGG + Intergenic
1012447832 6:99324641-99324663 TTTTGCTGGCCACCGTACCCAGG + Intronic
1013176992 6:107686361-107686383 TTTTTTCTGCCTGCATACCCAGG + Intergenic
1013232028 6:108168178-108168200 TTTTTGTTGCCCGCATTCCCGGG + Intronic
1020701411 7:11488562-11488584 TTATTTTTGCTACCATATCCAGG + Intronic
1021413342 7:20353526-20353548 TTTTTAATGCCGCCATCCTCAGG - Intronic
1021429428 7:20543446-20543468 TTTTTTTTACCCCCATACCATGG + Intergenic
1021467268 7:20959041-20959063 TTTTTATTCCCACCAAACTTGGG + Intergenic
1021547672 7:21833376-21833398 TTTTCATTGCCACTCTACCTTGG - Intronic
1024515879 7:50255148-50255170 TTTATAATGCTAGCATACCCTGG - Intergenic
1030122321 7:106121985-106122007 TGCTCATTGTCACCATACCCGGG - Intergenic
1031797213 7:126189941-126189963 TTTTTCTTGCCTCTTTACCCTGG - Intergenic
1034839493 7:154382536-154382558 TTTTTATTGTTACCATCCCATGG - Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036835789 8:12064840-12064862 TTGTTCTTGCCACCATGCCTAGG + Intronic
1036857632 8:12311413-12311435 TTGTTCTTGCCACCATGCCTAGG + Intergenic
1038207854 8:25485374-25485396 TTTATATTGCCATCTTACTCTGG + Intronic
1043045733 8:75321828-75321850 TTTTTTTTGCCTCCAATCCCAGG - Intergenic
1043136658 8:76535659-76535681 TTTCTAGTGCCATTATACCCTGG - Intergenic
1043829932 8:84975719-84975741 TTTGTGTTGCCACCAAATCCTGG - Intergenic
1047326362 8:123840443-123840465 TTTTTCTGCCCACCATACCAGGG - Intergenic
1047493034 8:125389956-125389978 TTTTTTTTACCACCATATCCTGG - Intergenic
1048233907 8:132672339-132672361 TTCCTCTTGCCACCATCCCCAGG + Intronic
1049262754 8:141648617-141648639 TTGCTATTGTCACCATAACCAGG - Intergenic
1050737735 9:8783587-8783609 AATTTAGTCCCACCATACCCTGG + Intronic
1051103813 9:13553900-13553922 TTTTTATTGTAAACATACCCAGG - Intergenic
1051843516 9:21425602-21425624 TTTTTATTGCCTGCTTGCCCTGG + Intronic
1053112093 9:35470025-35470047 TTTTTATTGCCAAAAAGCCCCGG - Intergenic
1056117477 9:83454910-83454932 TTTATCATGCCACCATACTCAGG + Intronic
1056121130 9:83490214-83490236 TTTCCATTGCAACCATCCCCAGG - Intronic
1185675761 X:1848150-1848172 TTTTTTTTGCCAACATTTCCTGG - Intergenic
1186140936 X:6572795-6572817 TTTTTTTTCCCAGCAAACCCAGG - Intergenic
1186630707 X:11345681-11345703 TTTATATTGCCACCTTACGCAGG + Intronic
1187416377 X:19096763-19096785 TATTTACTGCCTCCATACCTGGG + Intronic
1189762119 X:44332487-44332509 TTTTTATTTCCCCCTTACCCAGG - Intronic
1189890054 X:45591685-45591707 TTTCTATGGCCACCATAGCTGGG + Intergenic
1190972453 X:55364668-55364690 TTTATATTGCCCCCTTATCCTGG + Intergenic
1193897009 X:87127085-87127107 TTTCTATTGTTACCATACCTGGG - Intergenic
1194548717 X:95270665-95270687 TTTTTTTTTCCACCATAAACTGG + Intergenic
1199931659 X:152529841-152529863 TTTCTATAACCAGCATACCCTGG - Intergenic