ID: 998659269

View in Genome Browser
Species Human (GRCh38)
Location 5:144218154-144218176
Sequence GACCATATGCTTCTGTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998659269_998659271 -1 Left 998659269 5:144218154-144218176 CCTGTGAACAGAAGCATATGGTC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 998659271 5:144218176-144218198 CATTGTTGCCATGGAGCATATGG 0: 1
1: 0
2: 0
3: 9
4: 94
998659269_998659273 27 Left 998659269 5:144218154-144218176 CCTGTGAACAGAAGCATATGGTC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 998659273 5:144218204-144218226 AAAGAGATTAGAATAGTAAATGG No data
998659269_998659274 28 Left 998659269 5:144218154-144218176 CCTGTGAACAGAAGCATATGGTC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 998659274 5:144218205-144218227 AAGAGATTAGAATAGTAAATGGG No data
998659269_998659270 -10 Left 998659269 5:144218154-144218176 CCTGTGAACAGAAGCATATGGTC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 998659270 5:144218167-144218189 GCATATGGTCATTGTTGCCATGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998659269 Original CRISPR GACCATATGCTTCTGTTCAC AGG (reversed) Intronic
900844076 1:5082218-5082240 GCCCATTTGCTGCTGTTCTCAGG + Intergenic
907745774 1:57212233-57212255 GACCATTTGCTTCTCCTCACTGG - Intronic
908766757 1:67561205-67561227 CAGCATCTGCTTCTGTTCATAGG - Intergenic
915289464 1:154873434-154873456 GACCAGTTGCTTATGTTCTCAGG + Intergenic
915721918 1:157992343-157992365 GACCAGATACTTCTGCTCACAGG - Intergenic
916270160 1:162932341-162932363 GACCATAAGTCTCTGTTGACAGG + Intergenic
916486188 1:165261081-165261103 GACCCTGAGCTTCTGTGCACAGG - Intronic
920597019 1:207282220-207282242 GACCATATCCTGCTTTTCTCAGG + Intergenic
921725459 1:218518396-218518418 AGCCATATGCTTCTGTTCCAAGG + Intergenic
1066260691 10:33726932-33726954 GAGCATGTGCTTCTTTTCATGGG + Intergenic
1073080065 10:100854080-100854102 CATCATATGCTTCTGTGCCCCGG + Intergenic
1075572566 10:123556729-123556751 GACCCCATGCTCCCGTTCACTGG + Intergenic
1075653485 10:124145698-124145720 GACCATTCGCATCTCTTCACTGG - Intergenic
1076645159 10:131948702-131948724 CACCATAACCTGCTGTTCACAGG - Intronic
1084343389 11:68524909-68524931 AACCATGTGCCTCTGTGCACAGG - Intronic
1084771393 11:71344833-71344855 GATGAAATGCTGCTGTTCACAGG - Intergenic
1090452257 11:126817356-126817378 CACCATCAGCTTCTGTTGACTGG - Intronic
1091194489 11:133719727-133719749 GACCTGATGCTCCTGCTCACAGG + Intergenic
1093556162 12:20476698-20476720 GAACATATGCTTGAGTCCACAGG + Intronic
1093844392 12:23950898-23950920 GACCAGATGCTGCGGTGCACGGG - Intronic
1101102648 12:101408972-101408994 GTCCATAAGCTTCTGTTGAATGG - Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1108209139 13:48120799-48120821 GACCCCATGCTTCTGTTGATTGG + Intergenic
1109411566 13:61976567-61976589 GACCATTTGCTTCTGTGAACTGG + Intergenic
1115421147 14:33197500-33197522 GACAATATGCTCCTGGTCTCTGG - Intronic
1121946363 14:98126529-98126551 GAACATGTGCTTATGTTTACTGG + Intergenic
1125256216 15:37766471-37766493 GAGCATTTGCTTCTGTTCCGGGG + Intergenic
1126963920 15:54029822-54029844 GACCATATGCTCTGGTCCACCGG - Intronic
1127324466 15:57882004-57882026 GACCAGAAGCATCTTTTCACAGG - Intergenic
1128536640 15:68496269-68496291 GATCATATCTTTCTGTGCACGGG - Intergenic
1130052937 15:80498838-80498860 GCCCATCTGCTTCTGTTCGGTGG + Intronic
1131989915 15:98083206-98083228 GACCATTTGCTTTGGTTCTCAGG + Intergenic
1137043675 16:35637603-35637625 CACCATGTGCCTCTTTTCACAGG + Intergenic
1139560522 16:67738774-67738796 GACCATGGCCTTCTCTTCACTGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143264006 17:5622077-5622099 GAACAGAAGCTTCTGTCCACAGG + Intergenic
1143563154 17:7706991-7707013 GAACATAAGCTTGTTTTCACAGG + Intronic
1144327733 17:14197833-14197855 GCCCAGCTGCTTCTGTGCACAGG + Intronic
1158545233 18:58390624-58390646 GACCTTCTGCCTCTGTTCATAGG + Exonic
1158934533 18:62352447-62352469 GATCAGATGCTTCTGCTCAGTGG - Intronic
1167969579 19:53179604-53179626 CACCTTATGCATCTCTTCACTGG + Intronic
930053690 2:47236193-47236215 TACCCTATCCTGCTGTTCACAGG - Intergenic
946585061 2:221176816-221176838 GGCCATCTGCTTCTGTTGAGAGG - Intergenic
947895888 2:233671707-233671729 GACCATAAGCTACTGTTGTCTGG + Intronic
1169740739 20:8891280-8891302 GACCATATGCATATCTTCAGTGG + Intronic
1170608065 20:17888571-17888593 GACCATCTGCTTCTATGAACTGG + Intergenic
1174117027 20:48233370-48233392 GATCAAAGGCTTCTGTTCAAAGG + Intergenic
1175576562 20:60064959-60064981 GGCCCTATGCATCTCTTCACTGG + Intronic
1179877710 21:44279552-44279574 GACCATATGCTTCAGTTACAAGG - Intergenic
1181748443 22:24972320-24972342 GACCATATGCTTATGAGCACAGG - Intronic
955658019 3:61265319-61265341 GGACATATGCTTCTTTTCCCAGG + Intergenic
957456590 3:80458848-80458870 GAGCATATATTTCTTTTCACGGG + Intergenic
958790989 3:98650949-98650971 GACCATTACCTTCTGTTGACTGG + Intergenic
961239814 3:125400891-125400913 GACCACATGGTTATGGTCACGGG + Intergenic
962921611 3:139955460-139955482 GACCATTTGATTATGCTCACAGG + Intronic
967038732 3:185669819-185669841 CACCCTATGCTGCTGTTCTCAGG + Intronic
967725509 3:192858798-192858820 GACAATATACTTCTATTTACAGG + Intronic
971203593 4:24537715-24537737 TTACATATGCTTCTGCTCACCGG - Intronic
973589493 4:52426362-52426384 GAACTTATGATTCTGTTCTCTGG + Intergenic
974177473 4:58343180-58343202 GTACATATACTTCTGTTTACTGG + Intergenic
975690273 4:76956185-76956207 GACCAAAAACTTCTGTGCACGGG + Intronic
982072803 4:151710148-151710170 GACCATAGTCTTCTGTGCACTGG + Intronic
983357469 4:166681927-166681949 GGCCATTTGCCTCTGTTCTCAGG - Intergenic
986083635 5:4420423-4420445 GACCACATGCTTTTTTGCACAGG + Intergenic
989350247 5:40477933-40477955 AAAAATATGCTTCTGTTCAGAGG - Intergenic
997392488 5:133528422-133528444 GGCCATCTCCTTCTGTTCTCTGG + Intronic
998659269 5:144218154-144218176 GACCATATGCTTCTGTTCACAGG - Intronic
999826540 5:155278780-155278802 TTCCATAAGCTTCTGTTCTCAGG - Intergenic
1001924961 5:175629388-175629410 GACCATATGCTAATGCTGACTGG - Intergenic
1003333306 6:5147441-5147463 CACCATCTACTTCTGGTCACTGG - Intronic
1003354228 6:5351166-5351188 GGCCCTATGCTCCAGTTCACAGG - Intronic
1006152698 6:31997826-31997848 GACCATGTGCCTCTGCCCACAGG - Intronic
1006159006 6:32030563-32030585 GACCATGTGCCTCTGCCCACAGG - Intronic
1006577268 6:35055681-35055703 GAACAGAGGCTTCTGCTCACTGG + Intronic
1013707587 6:112856741-112856763 GACCATGTGCTTCTCTTCTTTGG + Intergenic
1021021570 7:15605070-15605092 GACCTGATGCTTCTGTTAAAAGG + Intergenic
1026548416 7:71345555-71345577 CACAACATGCCTCTGTTCACTGG - Intronic
1028715023 7:93955930-93955952 TACTATATGGTTCTGATCACTGG + Intergenic
1029889991 7:103918119-103918141 GACCATTTAGCTCTGTTCACCGG - Intronic
1031250536 7:119374631-119374653 GACCATATGTTGCTTTTCAATGG - Intergenic
1031391246 7:121217558-121217580 TGGCATATGCTTCAGTTCACTGG + Intronic
1033226708 7:139568496-139568518 GGCAATTTGCTTCTGCTCACTGG - Exonic
1033281666 7:140010221-140010243 GACAATCTGCTTCTGCTCAAAGG + Intronic
1039865483 8:41497793-41497815 GACTATGTGCCTCTGTACACAGG - Intronic
1043701889 8:83299314-83299336 GCCCATCTGCTTCTGGTCATGGG + Intergenic
1051466718 9:17386431-17386453 GAGCATATGCTTCACTTTACTGG - Intronic
1054735745 9:68748310-68748332 CACCATATCCTTCTCTCCACTGG + Intronic
1059213645 9:112538905-112538927 GACCATTTGCATATCTTCACTGG - Intronic
1186827990 X:13361015-13361037 GACCATAGGCTACTTTTTACAGG + Intergenic
1189178546 X:38982059-38982081 GACTATAATCTCCTGTTCACTGG - Intergenic
1190974166 X:55383641-55383663 GACCATATGATTCTATACCCAGG + Intergenic
1192799042 X:74448615-74448637 GACCCTATGCCTCTGTTTCCAGG + Intronic
1194128013 X:90043958-90043980 GAACGTTTTCTTCTGTTCACTGG - Intergenic
1195095235 X:101495050-101495072 AACCATATGCTGATATTCACTGG - Exonic
1195591809 X:106637835-106637857 AACCATATTCTTCTGTTCCCCGG - Exonic
1198470793 X:136944947-136944969 GACCAGATGTTTGTGTTCATGGG + Intergenic